Incidental Mutation 'R0242:Cd96'
ID 59606
Institutional Source Beutler Lab
Gene Symbol Cd96
Ensembl Gene ENSMUSG00000022657
Gene Name CD96 antigen
Synonyms 1700109I12Rik, Tactile
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 45856020-45940614 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45892129 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Methionine at position 286 (I286M)
Ref Sequence ENSEMBL: ENSMUSP00000023336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023336]
AlphaFold Q3U0X8
Predicted Effect possibly damaging
Transcript: ENSMUST00000023336
AA Change: I286M

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023336
Gene: ENSMUSG00000022657
AA Change: I286M

DomainStartEndE-ValueType
IG 30 137 1.63e-3 SMART
IG 145 247 1.12e-1 SMART
Blast:IG_like 257 357 3e-14 BLAST
low complexity region 434 448 N/A INTRINSIC
transmembrane domain 535 557 N/A INTRINSIC
low complexity region 571 580 N/A INTRINSIC
Meta Mutation Damage Score 0.1231 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein. The protein may play a role in the adhesive interactions of activated T and NK cells during the late phase of the immune response. It may also function in antigen presentation. Alternative splicing generates multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Cd96
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Cd96 APN 16 45,892,162 (GRCm39) missense possibly damaging 0.85
IGL00588:Cd96 APN 16 45,858,917 (GRCm39) missense probably benign 0.04
IGL00916:Cd96 APN 16 45,861,675 (GRCm39) missense probably benign 0.07
IGL01080:Cd96 APN 16 45,870,056 (GRCm39) missense possibly damaging 0.67
IGL01538:Cd96 APN 16 45,929,490 (GRCm39) missense possibly damaging 0.67
IGL02350:Cd96 APN 16 45,890,139 (GRCm39) splice site probably benign
IGL02357:Cd96 APN 16 45,890,139 (GRCm39) splice site probably benign
IGL02892:Cd96 APN 16 45,870,160 (GRCm39) critical splice acceptor site probably null
R0119:Cd96 UTSW 16 45,858,942 (GRCm39) splice site probably benign
R0242:Cd96 UTSW 16 45,892,129 (GRCm39) missense possibly damaging 0.88
R0515:Cd96 UTSW 16 45,884,268 (GRCm39) splice site probably benign
R0655:Cd96 UTSW 16 45,919,482 (GRCm39) missense probably benign 0.06
R0684:Cd96 UTSW 16 45,938,153 (GRCm39) missense possibly damaging 0.96
R0838:Cd96 UTSW 16 45,938,289 (GRCm39) missense probably damaging 1.00
R1531:Cd96 UTSW 16 45,938,169 (GRCm39) missense probably benign 0.03
R1664:Cd96 UTSW 16 45,938,364 (GRCm39) missense possibly damaging 0.95
R1791:Cd96 UTSW 16 45,938,362 (GRCm39) nonsense probably null
R1840:Cd96 UTSW 16 45,919,455 (GRCm39) missense probably benign 0.36
R1873:Cd96 UTSW 16 45,938,335 (GRCm39) missense probably damaging 1.00
R2895:Cd96 UTSW 16 45,938,168 (GRCm39) missense probably benign 0.43
R2906:Cd96 UTSW 16 45,871,850 (GRCm39) missense possibly damaging 0.56
R4291:Cd96 UTSW 16 45,892,112 (GRCm39) missense probably damaging 0.98
R5112:Cd96 UTSW 16 45,919,301 (GRCm39) missense probably benign
R5261:Cd96 UTSW 16 45,890,016 (GRCm39) missense probably benign 0.39
R5274:Cd96 UTSW 16 45,890,066 (GRCm39) missense possibly damaging 0.78
R5934:Cd96 UTSW 16 45,938,266 (GRCm39) missense probably benign 0.43
R6002:Cd96 UTSW 16 45,938,349 (GRCm39) missense possibly damaging 0.61
R6758:Cd96 UTSW 16 45,938,367 (GRCm39) missense possibly damaging 0.50
R6992:Cd96 UTSW 16 45,870,087 (GRCm39) missense possibly damaging 0.65
R7239:Cd96 UTSW 16 45,929,477 (GRCm39) missense probably damaging 1.00
R7308:Cd96 UTSW 16 45,892,097 (GRCm39) critical splice donor site probably null
R7316:Cd96 UTSW 16 45,890,016 (GRCm39) missense probably benign 0.39
R7355:Cd96 UTSW 16 45,861,655 (GRCm39) missense possibly damaging 0.51
R7553:Cd96 UTSW 16 45,872,384 (GRCm39) missense probably damaging 1.00
R7878:Cd96 UTSW 16 45,938,139 (GRCm39) missense probably damaging 1.00
R7921:Cd96 UTSW 16 45,858,843 (GRCm39) frame shift probably null
R8924:Cd96 UTSW 16 45,919,385 (GRCm39) missense probably damaging 1.00
R9089:Cd96 UTSW 16 45,870,068 (GRCm39) missense probably benign 0.23
R9295:Cd96 UTSW 16 45,938,244 (GRCm39) missense probably benign 0.38
R9433:Cd96 UTSW 16 45,856,298 (GRCm39) missense probably damaging 1.00
R9695:Cd96 UTSW 16 45,919,410 (GRCm39) missense probably damaging 0.96
X0017:Cd96 UTSW 16 45,870,137 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CCCCTTGGAGGAACAAGATGGTG -3'
(R):5'- TGCTCTGCCCTAGAGAATCAAGACC -3'

Sequencing Primer
(F):5'- TGTATCAGAAAGTGACGCCTAGTAG -3'
(R):5'- CAAGGCTTGTAAAGCCCTTGTG -3'
Posted On 2013-07-11