Incidental Mutation 'R7734:Tcf12'
ID596062
Institutional Source Beutler Lab
Gene Symbol Tcf12
Ensembl Gene ENSMUSG00000032228
Gene Nametranscription factor 12
SynonymsHTF-4, ALF1, HEB, bHLHb20, HEBAlt, REB, HTF4, ME1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location71842688-72111871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 71922661 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 173 (V173L)
Ref Sequence ENSEMBL: ENSMUSP00000139365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034755] [ENSMUST00000183404] [ENSMUST00000183492] [ENSMUST00000183594] [ENSMUST00000183992] [ENSMUST00000184072] [ENSMUST00000184107] [ENSMUST00000184416] [ENSMUST00000184523] [ENSMUST00000184783] [ENSMUST00000184867] [ENSMUST00000185117]
Predicted Effect probably benign
Transcript: ENSMUST00000034755
AA Change: V173L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034755
Gene: ENSMUSG00000032228
AA Change: V173L

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183404
AA Change: V173L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139365
Gene: ENSMUSG00000032228
AA Change: V173L

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183492
SMART Domains Protein: ENSMUSP00000138939
Gene: ENSMUSG00000032228

DomainStartEndE-ValueType
low complexity region 89 100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183594
Predicted Effect probably benign
Transcript: ENSMUST00000183647
Predicted Effect probably benign
Transcript: ENSMUST00000183992
AA Change: V173L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139084
Gene: ENSMUSG00000032228
AA Change: V173L

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 5e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000184072
AA Change: V81L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139284
Gene: ENSMUSG00000032228
AA Change: V81L

DomainStartEndE-ValueType
PDB:4JOL|H 85 108 4e-8 PDB
low complexity region 116 127 N/A INTRINSIC
low complexity region 164 180 N/A INTRINSIC
low complexity region 260 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184107
Predicted Effect probably benign
Transcript: ENSMUST00000184416
Predicted Effect probably benign
Transcript: ENSMUST00000184523
AA Change: V169L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138832
Gene: ENSMUSG00000032228
AA Change: V169L

DomainStartEndE-ValueType
PDB:4JOL|H 173 196 6e-8 PDB
low complexity region 204 215 N/A INTRINSIC
low complexity region 252 268 N/A INTRINSIC
low complexity region 348 359 N/A INTRINSIC
low complexity region 554 568 N/A INTRINSIC
HLH 603 656 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184783
AA Change: V173L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000139364
Gene: ENSMUSG00000032228
AA Change: V173L

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
HLH 607 660 7.54e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184867
Predicted Effect probably benign
Transcript: ENSMUST00000185117
AA Change: V173L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138925
Gene: ENSMUSG00000032228
AA Change: V173L

DomainStartEndE-ValueType
PDB:4JOL|H 177 200 7e-8 PDB
low complexity region 208 219 N/A INTRINSIC
low complexity region 256 272 N/A INTRINSIC
low complexity region 352 363 N/A INTRINSIC
low complexity region 534 548 N/A INTRINSIC
HLH 583 636 7.54e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the basic helix-loop-helix (bHLH) E-protein family that recognizes the consensus binding site (E-box) CANNTG. This encoded protein is expressed in many tissues, among them skeletal muscle, thymus, B- and T-cells, and may participate in regulating lineage-specific gene expression through the formation of heterodimers with other bHLH E-proteins. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit postnatal lethality within two weeks of birth and a 50% reduction in the number of pro-B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Tcf12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Tcf12 APN 9 71868118 missense probably damaging 0.98
IGL01311:Tcf12 APN 9 71858656 splice site probably benign
IGL01734:Tcf12 APN 9 71922648 splice site probably null
IGL01768:Tcf12 APN 9 71868996 splice site probably null
IGL02625:Tcf12 APN 9 71922757 missense probably damaging 1.00
IGL02671:Tcf12 APN 9 72109717 missense probably damaging 1.00
IGL03395:Tcf12 APN 9 71876022 missense probably damaging 1.00
Beneath UTSW 9 71883103 splice site probably null
depauperate UTSW 9 71868268 missense probably damaging 1.00
Poorly UTSW 9 71944016 nonsense probably null
Poorly2 UTSW 9 71858929 missense probably damaging 1.00
Poorly3 UTSW 9 72015636 critical splice donor site probably null
Substandard UTSW 9 71858840 missense probably null 0.54
R0183:Tcf12 UTSW 9 71917027 missense probably damaging 0.99
R0257:Tcf12 UTSW 9 71858622 missense probably benign 0.05
R1126:Tcf12 UTSW 9 72000433 missense probably benign 0.09
R1520:Tcf12 UTSW 9 71883106 critical splice donor site probably null
R1690:Tcf12 UTSW 9 71870072 critical splice donor site probably null
R1819:Tcf12 UTSW 9 72109717 missense probably damaging 1.00
R1850:Tcf12 UTSW 9 71868215 missense probably damaging 1.00
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R1888:Tcf12 UTSW 9 71858534 missense possibly damaging 0.89
R2402:Tcf12 UTSW 9 71856510 missense probably damaging 1.00
R4445:Tcf12 UTSW 9 71869063 missense probably damaging 0.99
R4693:Tcf12 UTSW 9 71868967 intron probably benign
R4814:Tcf12 UTSW 9 71870041 intron probably benign
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4860:Tcf12 UTSW 9 71858840 missense probably null 0.54
R4885:Tcf12 UTSW 9 71858840 missense probably null 0.54
R5347:Tcf12 UTSW 9 71885243 missense probably damaging 1.00
R5422:Tcf12 UTSW 9 71869038 missense probably damaging 1.00
R5650:Tcf12 UTSW 9 71885302 splice site probably null
R5713:Tcf12 UTSW 9 71885263 makesense probably null
R5789:Tcf12 UTSW 9 71885236 missense probably damaging 1.00
R5964:Tcf12 UTSW 9 71868240 missense probably damaging 1.00
R6012:Tcf12 UTSW 9 71858947 missense possibly damaging 0.62
R6119:Tcf12 UTSW 9 71868265 missense probably damaging 1.00
R6240:Tcf12 UTSW 9 71944016 nonsense probably null
R6299:Tcf12 UTSW 9 71858929 missense probably damaging 1.00
R6449:Tcf12 UTSW 9 71868268 missense probably damaging 1.00
R6489:Tcf12 UTSW 9 72015636 critical splice donor site probably null
R6984:Tcf12 UTSW 9 72006759 nonsense probably null
R7146:Tcf12 UTSW 9 71883103 splice site probably null
R8007:Tcf12 UTSW 9 71934623 intron probably benign
R8161:Tcf12 UTSW 9 72015651 missense probably damaging 1.00
R8709:Tcf12 UTSW 9 71858505 missense possibly damaging 0.62
R8709:Tcf12 UTSW 9 71922787 missense probably benign 0.00
R8711:Tcf12 UTSW 9 71849815 missense possibly damaging 0.77
X0021:Tcf12 UTSW 9 71883172 missense probably damaging 0.99
X0022:Tcf12 UTSW 9 72109743 missense probably damaging 0.99
Z1177:Tcf12 UTSW 9 72000460 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TTTGGATTGGGAATACTCAGCC -3'
(R):5'- AATTTCAAGGCATCGATTCAGG -3'

Sequencing Primer
(F):5'- CCCTGACTTCCAAATGATGA -3'
(R):5'- TGACGAGCTTGATCATTAGCAGC -3'
Posted On2019-11-12