Incidental Mutation 'R7734:Mfsd4b1'
ID596068
Institutional Source Beutler Lab
Gene Symbol Mfsd4b1
Ensembl Gene ENSMUSG00000038522
Gene Namemajor facilitator superfamily domain containing 4B1
SynonymsAI317395
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location40001575-40025268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40007378 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 25 (N25K)
Ref Sequence ENSEMBL: ENSMUSP00000128324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163705]
Predicted Effect probably damaging
Transcript: ENSMUST00000163705
AA Change: N25K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128324
Gene: ENSMUSG00000038522
AA Change: N25K

DomainStartEndE-ValueType
Pfam:MFS_1 1 369 1.9e-15 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Mfsd4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01650:Mfsd4b1 APN 10 40003119 missense probably benign 0.16
IGL03356:Mfsd4b1 APN 10 40002831 missense probably damaging 0.97
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1467:Mfsd4b1 UTSW 10 40002635 missense possibly damaging 0.93
R1770:Mfsd4b1 UTSW 10 40003227 missense probably damaging 0.99
R1930:Mfsd4b1 UTSW 10 40006074 missense probably benign 0.01
R2122:Mfsd4b1 UTSW 10 40002651 missense possibly damaging 0.91
R2290:Mfsd4b1 UTSW 10 40003331 missense probably damaging 0.99
R3508:Mfsd4b1 UTSW 10 40002719 missense probably benign 0.15
R4469:Mfsd4b1 UTSW 10 40012095 intron probably benign
R4594:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
R5300:Mfsd4b1 UTSW 10 40003031 missense probably benign
R6250:Mfsd4b1 UTSW 10 40003110 missense possibly damaging 0.92
R6426:Mfsd4b1 UTSW 10 40006077 missense possibly damaging 0.95
R7061:Mfsd4b1 UTSW 10 40003386 missense possibly damaging 0.83
R7595:Mfsd4b1 UTSW 10 40003225 nonsense probably null
R7737:Mfsd4b1 UTSW 10 40003278 missense probably damaging 0.97
R7852:Mfsd4b1 UTSW 10 40003415 missense probably benign 0.23
R7893:Mfsd4b1 UTSW 10 40007317 missense probably benign 0.00
X0063:Mfsd4b1 UTSW 10 40007307 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGTTGTCAAGCATTCTGC -3'
(R):5'- AACTGCTGCGGATCTCAAAAG -3'

Sequencing Primer
(F):5'- GTGCTTGCCACACAGAGACTAAG -3'
(R):5'- GCTGCGGATCTCAAAAGCAACC -3'
Posted On2019-11-12