Incidental Mutation 'R7734:3110002H16Rik'
ID596089
Institutional Source Beutler Lab
Gene Symbol 3110002H16Rik
Ensembl Gene ENSMUSG00000024410
Gene NameRIKEN cDNA 3110002H16 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location12168717-12189997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12189263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 591 (I591N)
Ref Sequence ENSEMBL: ENSMUSP00000025276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025276] [ENSMUST00000025279] [ENSMUST00000134046] [ENSMUST00000138866]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025276
AA Change: I591N

PolyPhen 2 Score 0.814 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025276
Gene: ENSMUSG00000024410
AA Change: I591N

DomainStartEndE-ValueType
SCOP:d1crza1 21 169 5e-4 SMART
low complexity region 268 281 N/A INTRINSIC
Pfam:Mic1 475 632 4.4e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025279
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134046
SMART Domains Protein: ENSMUSP00000118783
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 58 71 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138866
SMART Domains Protein: ENSMUSP00000121414
Gene: ENSMUSG00000024410

DomainStartEndE-ValueType
low complexity region 37 50 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a colon cancer associated protein. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Pde6a T C 18: 61,232,866 I221T probably benign Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in 3110002H16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:3110002H16Rik APN 18 12179219 missense probably benign 0.00
IGL01883:3110002H16Rik APN 18 12178239 missense probably benign 0.03
IGL01956:3110002H16Rik APN 18 12189350 missense probably damaging 0.99
IGL02828:3110002H16Rik APN 18 12189221 missense possibly damaging 0.52
IGL03147:3110002H16Rik APN 18 12169229 splice site probably benign
R0147:3110002H16Rik UTSW 18 12189271 missense probably damaging 0.99
R0357:3110002H16Rik UTSW 18 12179209 missense possibly damaging 0.87
R1108:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1422:3110002H16Rik UTSW 18 12181623 missense probably damaging 0.99
R1939:3110002H16Rik UTSW 18 12180505 missense probably damaging 1.00
R4300:3110002H16Rik UTSW 18 12188862 missense probably benign 0.00
R4826:3110002H16Rik UTSW 18 12185779 intron probably benign
R5103:3110002H16Rik UTSW 18 12189262 missense probably benign
R5345:3110002H16Rik UTSW 18 12179177 missense probably benign
R5506:3110002H16Rik UTSW 18 12188956 unclassified probably benign
R5566:3110002H16Rik UTSW 18 12180692 missense possibly damaging 0.90
R5574:3110002H16Rik UTSW 18 12185006 frame shift probably null
R5632:3110002H16Rik UTSW 18 12171583 missense possibly damaging 0.63
R6331:3110002H16Rik UTSW 18 12180514 missense probably damaging 0.99
R6765:3110002H16Rik UTSW 18 12176146 missense possibly damaging 0.82
R6978:3110002H16Rik UTSW 18 12185747 missense probably benign
R7310:3110002H16Rik UTSW 18 12184915 missense probably benign 0.13
R7792:3110002H16Rik UTSW 18 12181599 missense probably damaging 1.00
R7830:3110002H16Rik UTSW 18 12168871 missense probably benign 0.16
R7885:3110002H16Rik UTSW 18 12189314 missense probably damaging 1.00
R8047:3110002H16Rik UTSW 18 12180529 missense possibly damaging 0.67
R8144:3110002H16Rik UTSW 18 12185647 critical splice acceptor site probably null
R8157:3110002H16Rik UTSW 18 12188633 missense possibly damaging 0.95
R8870:3110002H16Rik UTSW 18 12188561 missense probably benign
X0062:3110002H16Rik UTSW 18 12179519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAGCTTTTATCCTCCCGC -3'
(R):5'- ACTTGATGAAAGCTGCCATTGTC -3'

Sequencing Primer
(F):5'- CAGCTATCTCTGGACATGTTGAAG -3'
(R):5'- AAAGCTGCCATTGTCTGTGG -3'
Posted On2019-11-12