Incidental Mutation 'R7734:Pde6a'
ID596090
Institutional Source Beutler Lab
Gene Symbol Pde6a
Ensembl Gene ENSMUSG00000024575
Gene Namephosphodiesterase 6A, cGMP-specific, rod, alpha
SynonymsPdea
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7734 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location61220482-61289924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 61232866 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 221 (I221T)
Ref Sequence ENSEMBL: ENSMUSP00000025468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025468]
Predicted Effect probably benign
Transcript: ENSMUST00000025468
AA Change: I221T

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: I221T

DomainStartEndE-ValueType
GAF 73 232 1.36e-21 SMART
GAF 254 441 3.21e-23 SMART
low complexity region 478 495 N/A INTRINSIC
Blast:HDc 496 540 3e-11 BLAST
HDc 556 734 6.95e-8 SMART
Blast:HDc 759 786 1e-8 BLAST
low complexity region 817 837 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110002H16Rik T A 18: 12,189,263 I591N possibly damaging Het
Anxa2 T C 9: 69,491,482 Y333H probably benign Het
Arid1a A T 4: 133,681,368 F1558I unknown Het
Aste1 A G 9: 105,397,479 D306G probably damaging Het
Atp2a2 A G 5: 122,458,527 V843A possibly damaging Het
Atrip T A 9: 109,065,506 H451L probably benign Het
Cdc42bpb T C 12: 111,329,230 D200G probably damaging Het
Ceacam19 A C 7: 19,886,595 M37R probably benign Het
Cemip G A 7: 83,957,664 R782* probably null Het
Cpe A T 8: 64,617,620 I197N probably benign Het
Csmd2 C A 4: 128,552,057 P3307T Het
Cyp4a12b C A 4: 115,411,740 Q20K possibly damaging Het
Dcaf1 T C 9: 106,838,679 Y332H probably damaging Het
Dclk3 A G 9: 111,469,095 H569R probably damaging Het
Dcp1b A G 6: 119,215,283 S387G probably benign Het
Ddx24 A G 12: 103,417,560 M590T possibly damaging Het
Dixdc1 T G 9: 50,701,968 Q229P probably damaging Het
Dnase1l3 T C 14: 7,977,144 R181G probably benign Het
Dzip1l A T 9: 99,667,682 D735V probably damaging Het
Edem3 T C 1: 151,818,585 S890P probably benign Het
Fuom A G 7: 140,099,542 L155P unknown Het
Gm6408 C A 5: 146,484,350 S263* probably null Het
Helz C G 11: 107,685,422 S1814R unknown Het
Hrc T C 7: 45,336,676 L417P probably benign Het
Igdcc4 A C 9: 65,131,753 H894P probably damaging Het
Lgr6 C A 1: 135,003,243 V296L probably damaging Het
Map3k4 T A 17: 12,264,111 Y573F probably damaging Het
Mest T C 6: 30,746,300 Y296H unknown Het
Mettl21a C T 1: 64,608,129 V90M probably damaging Het
Mfsd4b1 A T 10: 40,007,378 N25K probably damaging Het
Mmd T A 11: 90,276,753 F203I probably damaging Het
Myo15 G A 11: 60,510,282 V3028M probably benign Het
Nlrp1a T A 11: 71,108,000 N859I unknown Het
Nrcam T C 12: 44,537,251 L36P possibly damaging Het
Nup107 C A 10: 117,758,012 E759* probably null Het
Olfr305 A G 7: 86,364,268 I23T not run Het
Pcdh7 T G 5: 57,719,634 I177S probably damaging Het
Ptpn13 A T 5: 103,561,962 N1497I probably damaging Het
Rpl4 T A 9: 64,177,379 H245Q probably benign Het
Rsf1 C CCACGGCGGG 7: 97,579,908 probably benign Het
Scara5 A G 14: 65,731,151 D291G possibly damaging Het
Sept14 T A 5: 129,683,519 I422L probably benign Het
Serpina1e T C 12: 103,950,892 K173E probably benign Het
Slc5a1 C T 5: 33,160,935 T644I probably benign Het
Slc6a13 A T 6: 121,337,375 T590S probably benign Het
Smarca4 C T 9: 21,667,362 T938I possibly damaging Het
Stxbp1 A T 2: 32,801,820 D453E probably benign Het
Tcf12 C A 9: 71,922,661 V173L probably benign Het
Tenm3 A G 8: 48,646,333 C146R probably damaging Het
Trim11 T C 11: 58,978,354 C39R probably damaging Het
Trim37 A G 11: 87,177,995 Y389C probably damaging Het
Ttll8 C T 15: 88,914,165 G789D probably damaging Het
Tubb2a C T 13: 34,074,793 S338N probably benign Het
Ulk2 G A 11: 61,853,301 Q50* probably null Het
Urgcp T C 11: 5,716,406 D687G probably benign Het
Usp13 C T 3: 32,837,905 H78Y probably benign Het
Vmn2r100 T A 17: 19,522,034 D223E probably benign Het
Vwc2 G A 11: 11,115,929 A6T possibly damaging Het
Other mutations in Pde6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Pde6a APN 18 61257268 missense probably damaging 1.00
IGL00896:Pde6a APN 18 61220792 missense possibly damaging 0.94
IGL01595:Pde6a APN 18 61281528 missense probably damaging 0.98
IGL02971:Pde6a APN 18 61264255 missense probably damaging 1.00
caffeinated UTSW 18 61220606 start codon destroyed probably null 0.95
R0219:Pde6a UTSW 18 61285935 missense possibly damaging 0.57
R0968:Pde6a UTSW 18 61253738 missense probably damaging 0.99
R1304:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R1498:Pde6a UTSW 18 61232860 missense possibly damaging 0.73
R1542:Pde6a UTSW 18 61257045 missense possibly damaging 0.93
R1734:Pde6a UTSW 18 61285965 missense probably damaging 1.00
R1795:Pde6a UTSW 18 61257212 missense probably damaging 1.00
R2173:Pde6a UTSW 18 61254382 missense probably damaging 1.00
R2280:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R2281:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R3617:Pde6a UTSW 18 61231503 splice site probably benign
R4620:Pde6a UTSW 18 61262492 missense probably damaging 1.00
R4727:Pde6a UTSW 18 61231489 missense probably benign 0.02
R4863:Pde6a UTSW 18 61245592 missense probably damaging 1.00
R4904:Pde6a UTSW 18 61265034 missense probably benign 0.08
R4945:Pde6a UTSW 18 61234718 missense probably damaging 1.00
R4953:Pde6a UTSW 18 61231362 nonsense probably null
R5323:Pde6a UTSW 18 61232911 missense possibly damaging 0.81
R5496:Pde6a UTSW 18 61253665 critical splice acceptor site probably null
R5540:Pde6a UTSW 18 61231366 missense probably damaging 0.99
R6180:Pde6a UTSW 18 61284092 splice site probably null
R6366:Pde6a UTSW 18 61265071 splice site probably null
R6743:Pde6a UTSW 18 61263986 missense possibly damaging 0.48
R7161:Pde6a UTSW 18 61281525 missense probably benign 0.05
R7186:Pde6a UTSW 18 61220606 start codon destroyed probably null 0.95
R7197:Pde6a UTSW 18 61258224 missense probably damaging 0.96
R7296:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R7487:Pde6a UTSW 18 61249960 missense probably damaging 1.00
R7818:Pde6a UTSW 18 61281509 splice site probably null
R8104:Pde6a UTSW 18 61231494 missense probably damaging 0.99
R8135:Pde6a UTSW 18 61285925 missense probably damaging 0.98
R8213:Pde6a UTSW 18 61220696 missense possibly damaging 0.94
R8266:Pde6a UTSW 18 61258213 missense probably damaging 1.00
R8429:Pde6a UTSW 18 61232844 missense probably damaging 0.98
R8472:Pde6a UTSW 18 61220946 missense probably damaging 1.00
R8805:Pde6a UTSW 18 61257033 missense probably benign 0.13
R8882:Pde6a UTSW 18 61245548 missense
RF018:Pde6a UTSW 18 61231403 missense possibly damaging 0.84
X0064:Pde6a UTSW 18 61264948 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATTCACAGTGCAACGAGTG -3'
(R):5'- ACCTTCTAATACTGGGGTCTCC -3'

Sequencing Primer
(F):5'- CGAGTGAGGAAGGAGTCTGCAC -3'
(R):5'- GGTCTCCCACCTGACACAG -3'
Posted On2019-11-12