Incidental Mutation 'R7389:Tinf2'
ID596095
Institutional Source Beutler Lab
Gene Symbol Tinf2
Ensembl Gene ENSMUSG00000007589
Gene NameTerf1 (TRF1)-interacting nuclear factor 2
SynonymsD14Wsu146e, TIN2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7389 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55674689-55681820 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 55680710 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000007733] [ENSMUST00000226314] [ENSMUST00000227842] [ENSMUST00000227873] [ENSMUST00000227914]
Predicted Effect probably benign
Transcript: ENSMUST00000002397
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably null
Transcript: ENSMUST00000007733
SMART Domains Protein: ENSMUSP00000007733
Gene: ENSMUSG00000007589

DomainStartEndE-ValueType
Pfam:TINF2_N 20 159 1.8e-41 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000226314
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect probably null
Transcript: ENSMUST00000227842
Predicted Effect probably null
Transcript: ENSMUST00000227873
Predicted Effect probably benign
Transcript: ENSMUST00000227914
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins of the shelterin, or telosome, complex which protects telomeres by allowing the cell to distinguish between telomeres and regions of DNA damage. The protein encoded by this gene is a critical part of shelterin; it interacts with the three DNA-binding proteins of the shelterin complex, and it is important for assembly of the complex. Mutations in this gene cause dyskeratosis congenita (DKC), an inherited bone marrow failure syndrome. [provided by RefSeq, Mar 2010]
PHENOTYPE: Targeted disruption of this gene results in embryonic lethality prior to E7.5 through a mechanism that is independent of telomerase function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anxa11 C A 14: 25,872,888 P182Q probably damaging Het
Asns C A 6: 7,689,291 L70F probably damaging Het
Cd163l1 A G 7: 140,228,791 K872E possibly damaging Het
Cntrl A T 2: 35,127,517 K445N probably benign Het
Cyp2c50 G T 19: 40,090,663 R150L probably benign Het
Dqx1 G T 6: 83,064,794 S539I probably null Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Epha3 T C 16: 63,772,984 E247G probably damaging Het
Etl4 C T 2: 20,785,093 Q801* probably null Het
Fabp2 G T 3: 122,895,365 probably benign Het
Fsip2 G A 2: 82,988,796 V4958I possibly damaging Het
Fstl3 G A 10: 79,780,031 C117Y probably damaging Het
Hdgfl2 T G 17: 56,099,389 probably null Het
Igfn1 T C 1: 135,967,047 D1927G probably benign Het
Ino80 A C 2: 119,442,529 S489A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrriq3 A G 3: 155,188,104 T481A probably benign Het
Map2k3 A T 11: 60,932,036 probably benign Het
Matr3 A G 18: 35,584,585 T617A probably benign Het
Mybpc2 T G 7: 44,505,604 T960P probably benign Het
Ncoa2 T C 1: 13,186,825 N150S possibly damaging Het
Nup153 A T 13: 46,700,987 probably null Het
Obscn A G 11: 59,036,400 L5498P probably benign Het
Olfr111 A G 17: 37,530,657 R227G possibly damaging Het
Olfr1444 G T 19: 12,862,617 V281L probably benign Het
Paqr8 C A 1: 20,935,165 P181Q probably damaging Het
Pcdhgb4 T C 18: 37,722,363 Y604H probably damaging Het
Pja2 T A 17: 64,297,727 E487V probably damaging Het
Pnpla6 C T 8: 3,543,981 R1331* probably null Het
Ppl T A 16: 5,106,713 probably null Het
Rhbdl3 T A 11: 80,346,839 M299K possibly damaging Het
Slc26a9 A G 1: 131,769,248 *791W probably null Het
Slc7a2 A G 8: 40,912,515 Y461C probably benign Het
Sptb G T 12: 76,624,229 Q447K probably damaging Het
Ssh1 A T 5: 113,958,831 I205N probably benign Het
Stab1 C T 14: 31,147,239 V1511I probably benign Het
Tex19.1 T C 11: 121,147,160 W115R possibly damaging Het
Tmeff1 A G 4: 48,617,097 probably null Het
Tnip2 G T 5: 34,513,801 Q33K probably benign Het
Traf3 C A 12: 111,237,753 L59M probably damaging Het
Trav14d-3-dv8 T C 14: 53,078,871 Y63H possibly damaging Het
Trim11 C T 11: 58,990,655 S458L probably damaging Het
Tspan18 A T 2: 93,209,927 V161E probably benign Het
Usf3 T A 16: 44,217,941 V928E probably benign Het
Usp29 G A 7: 6,963,458 V767I possibly damaging Het
Usp34 T G 11: 23,345,200 F287L Het
Vmn1r213 T C 13: 23,012,386 C380R probably benign Het
Zfyve9 A G 4: 108,693,318 probably null Het
Other mutations in Tinf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Tinf2 APN 14 55680464 unclassified probably null
IGL01879:Tinf2 APN 14 55680906 unclassified probably benign
IGL03123:Tinf2 APN 14 55680889 missense probably damaging 0.99
R0815:Tinf2 UTSW 14 55680109 missense probably benign 0.01
R0863:Tinf2 UTSW 14 55680109 missense probably benign 0.01
R2862:Tinf2 UTSW 14 55680631 missense probably damaging 1.00
R5575:Tinf2 UTSW 14 55680174 missense probably benign 0.23
R6833:Tinf2 UTSW 14 55681580 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- CCATATAACTTCCATTCGGCTGAC -3'
(R):5'- GCTTCACTTTCCCACATACAGG -3'

Sequencing Primer
(F):5'- CTGACTCAGGTTTGGTAGAGCTAAAC -3'
(R):5'- GAACAAGACTATGGGGAATCCTTTC -3'
Posted On2019-11-18