Incidental Mutation 'R7391:Hmmr'
ID596102
Institutional Source Beutler Lab
Gene Symbol Hmmr
Ensembl Gene ENSMUSG00000020330
Gene Namehyaluronan mediated motility receptor (RHAMM)
SynonymsCD168, Rhamm
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7391 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location40701395-40733422 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 40707786 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000020579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020579]
Predicted Effect probably null
Transcript: ENSMUST00000020579
SMART Domains Protein: ENSMUSP00000020579
Gene: ENSMUSG00000020330

DomainStartEndE-ValueType
Pfam:HMMR_N 15 339 1.2e-136 PFAM
low complexity region 375 385 N/A INTRINSIC
low complexity region 430 442 N/A INTRINSIC
Blast:MA 452 578 7e-6 BLAST
Pfam:HMMR_C 636 789 4.3e-71 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in cell motility. It is expressed in breast tissue and together with other proteins, it forms a complex with BRCA1 and BRCA2, thus is potentially associated with higher risk of breast cancer. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit impaired fertility and are less susceptible to the formation of aggressive fibromatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arfgef3 A T 10: 18,646,259 I673K probably benign Het
Arhgap32 C A 9: 32,181,939 T196K probably benign Het
Azi2 T A 9: 118,050,892 probably null Het
B3gnt2 A T 11: 22,836,482 C235* probably null Het
BC080695 T A 4: 143,572,306 L273H probably damaging Het
Capn5 C T 7: 98,131,219 V315M probably benign Het
Ccl24 T A 5: 135,570,822 R111S possibly damaging Het
Cdk9 A G 2: 32,712,071 V45A probably damaging Het
Cep162 G T 9: 87,248,494 S21* probably null Het
Chil3 T A 3: 106,164,180 Y56F probably damaging Het
Ctr9 T A 7: 111,043,171 L368* probably null Het
Ctss A G 3: 95,529,541 E45G probably benign Het
Cyp2c29 A T 19: 39,307,767 Q214L probably null Het
Cyp2d34 T A 15: 82,618,386 N183I probably benign Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Ermp1 C A 19: 29,627,068 probably null Het
Ermp1 T A 19: 29,627,069 probably null Het
Evi2 A G 11: 79,515,667 S361P probably benign Het
Ext2 T A 2: 93,730,267 K518M probably damaging Het
Fgl1 A C 8: 41,210,446 M15R probably benign Het
Fsip2 T G 2: 82,990,319 D5465E possibly damaging Het
Hdlbp A T 1: 93,431,061 I256N possibly damaging Het
Hnrnpu T C 1: 178,337,078 Q165R unknown Het
Homer3 G A 8: 70,289,484 A132T probably benign Het
Ikbkap C A 4: 56,781,211 Q487H possibly damaging Het
Ikbkap T G 4: 56,781,212 Q487P probably benign Het
Kcnb1 T C 2: 167,105,450 R493G probably damaging Het
Kcnn3 A T 3: 89,609,471 T396S probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krtap4-1 A G 11: 99,627,984 S67P unknown Het
Lama4 G T 10: 39,087,387 probably null Het
Lrrtm2 T A 18: 35,212,765 I495F possibly damaging Het
Mical2 A T 7: 112,320,609 E442V probably damaging Het
Muc16 C T 9: 18,639,536 V5154I probably benign Het
Nav3 A T 10: 109,703,456 M2028K probably benign Het
Ncr1 T A 7: 4,344,471 W249R possibly damaging Het
Neurod6 T C 6: 55,679,631 D7G probably damaging Het
Nwd1 A G 8: 72,662,418 E158G probably damaging Het
Olfr132 A T 17: 38,131,050 F47L probably benign Het
Olfr1328 A T 4: 118,934,001 N282K possibly damaging Het
Olfr1381 T C 11: 49,552,544 S266P probably damaging Het
Olfr1395 A G 11: 49,148,979 T241A probably damaging Het
Olfr33 T C 7: 102,713,982 N144D probably benign Het
Padi2 A G 4: 140,937,955 D457G probably benign Het
Parn C A 16: 13,668,006 probably null Het
Pcdh1 C T 18: 38,202,785 E266K possibly damaging Het
Pigr A G 1: 130,849,566 D703G probably damaging Het
Ppm1f T A 16: 16,914,234 S183T probably benign Het
Ppp2r5b T A 19: 6,228,514 Q455L probably benign Het
Ptpn13 C T 5: 103,540,981 S880L probably damaging Het
R3hdm4 T C 10: 79,911,109 K240R probably benign Het
Rin1 T C 19: 5,050,860 M1T probably null Het
Rundc3b T A 5: 8,559,455 M170L probably benign Het
Ryr3 A T 2: 112,780,977 probably null Het
Scn11a T C 9: 119,795,717 D513G probably damaging Het
Slc27a2 C A 2: 126,553,162 P3Q unknown Het
Slc4a8 A G 15: 100,784,862 I187M probably damaging Het
Slc6a11 A T 6: 114,238,461 I441F probably benign Het
Stx2 C T 5: 128,988,803 R263Q probably damaging Het
Svep1 A T 4: 58,145,185 W427R probably damaging Het
Tes T A 6: 17,096,167 H51Q probably damaging Het
Thnsl2 T C 6: 71,131,930 D299G probably damaging Het
Tmem30b T C 12: 73,545,928 S138G probably benign Het
Tmprss11c T A 5: 86,237,791 H274L probably damaging Het
Trim10 G A 17: 36,869,881 M1I probably null Het
Ttc30a1 T C 2: 75,980,015 K575E probably benign Het
Unc13b A G 4: 43,216,459 I253V probably benign Het
Unc80 A G 1: 66,695,528 S3305G probably benign Het
Ush2a TCACC TC 1: 188,962,008 probably benign Het
Virma A G 4: 11,508,099 D267G probably damaging Het
Vmn1r46 C T 6: 89,976,625 S152L probably benign Het
Wdr90 T C 17: 25,846,528 N1621S probably benign Het
Zfhx3 G A 8: 108,947,843 A1842T probably damaging Het
Zfp583 A G 7: 6,316,499 S505P probably damaging Het
Zfp608 T C 18: 54,897,547 Y1107C possibly damaging Het
Zfp616 A G 11: 74,085,329 H808R probably benign Het
Zfp677 T C 17: 21,398,391 F570S possibly damaging Het
Zfp85 A T 13: 67,749,291 Y221N probably damaging Het
Other mutations in Hmmr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01795:Hmmr APN 11 40721734 missense probably benign 0.25
IGL02096:Hmmr APN 11 40707429 missense probably benign 0.02
IGL02224:Hmmr APN 11 40710004 missense unknown
IGL02527:Hmmr APN 11 40708105 missense probably damaging 1.00
IGL02870:Hmmr APN 11 40714075 missense possibly damaging 0.63
IGL03175:Hmmr APN 11 40714809 missense probably benign 0.02
IGL03327:Hmmr APN 11 40715415 missense probably damaging 1.00
R0126:Hmmr UTSW 11 40705954 missense probably damaging 1.00
R0211:Hmmr UTSW 11 40714808 missense probably damaging 0.96
R0533:Hmmr UTSW 11 40709989 missense unknown
R0610:Hmmr UTSW 11 40715902 missense probably damaging 1.00
R0747:Hmmr UTSW 11 40721745 splice site probably benign
R1909:Hmmr UTSW 11 40708098 missense probably damaging 1.00
R2013:Hmmr UTSW 11 40728432 missense possibly damaging 0.85
R4446:Hmmr UTSW 11 40715321 missense probably damaging 1.00
R4897:Hmmr UTSW 11 40728434 missense probably benign 0.00
R4937:Hmmr UTSW 11 40721840 missense possibly damaging 0.90
R5795:Hmmr UTSW 11 40721906 missense probably damaging 1.00
R5873:Hmmr UTSW 11 40707700 missense probably damaging 0.99
R6414:Hmmr UTSW 11 40715867 critical splice donor site probably null
R6962:Hmmr UTSW 11 40707415 missense probably damaging 1.00
R7558:Hmmr UTSW 11 40733329 missense probably damaging 1.00
R8065:Hmmr UTSW 11 40721672 missense not run
R8066:Hmmr UTSW 11 40721672 missense not run
T0975:Hmmr UTSW 11 40723416 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAGCTGCTTCCTAAAGTC -3'
(R):5'- ACAGCAGATATTGACAGCTGAG -3'

Sequencing Primer
(F):5'- CTAAAGTCTTCATCTTGTTGTCTGAG -3'
(R):5'- GAGACGGTCTCACAATTTAGTCTTG -3'
Posted On2019-11-18