Incidental Mutation 'R7399:Rfxank'
ID596116
Institutional Source Beutler Lab
Gene Symbol Rfxank
Ensembl Gene ENSMUSG00000036120
Gene Nameregulatory factor X-associated ankyrin-containing protein
SynonymsTvl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7399 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location70130794-70139154 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 70135286 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002418] [ENSMUST00000075724] [ENSMUST00000095273] [ENSMUST00000110139] [ENSMUST00000123760] [ENSMUST00000129668] [ENSMUST00000163756] [ENSMUST00000211898] [ENSMUST00000212320]
Predicted Effect probably benign
Transcript: ENSMUST00000002418
SMART Domains Protein: ENSMUSP00000002418
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 119 1.7e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075724
SMART Domains Protein: ENSMUSP00000075140
Gene: ENSMUSG00000036120

DomainStartEndE-ValueType
ANK 132 161 1.36e-2 SMART
ANK 165 194 5.16e-3 SMART
ANK 198 227 7.42e-4 SMART
ANK 231 260 2.35e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095273
SMART Domains Protein: ENSMUSP00000092907
Gene: ENSMUSG00000071078

DomainStartEndE-ValueType
SCOP:d1jhja_ 22 64 6e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110139
SMART Domains Protein: ENSMUSP00000105766
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 107 2.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123760
SMART Domains Protein: ENSMUSP00000118102
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129668
SMART Domains Protein: ENSMUSP00000137694
Gene: ENSMUSG00000002345

DomainStartEndE-ValueType
Pfam:NEP 1 78 2.4e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163756
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211898
Predicted Effect probably null
Transcript: ENSMUST00000212320
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,260,679 V801G possibly damaging Het
Actbl2 T A 13: 111,255,593 M154K probably benign Het
Adam7 A T 14: 68,504,466 probably null Het
Arfgef1 T A 1: 10,180,897 T888S probably benign Het
AW554918 C T 18: 25,169,060 P10L possibly damaging Het
Bcap29 A G 12: 31,630,882 I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
C87499 C A 4: 88,627,965 R380L probably benign Het
Cdc25b A G 2: 131,194,654 D458G probably damaging Het
Cdc42bpb T C 12: 111,305,667 K1104R probably benign Het
Cep89 A G 7: 35,438,378 N729S probably damaging Het
Clec4a4 T A 6: 122,991,829 M51K possibly damaging Het
Dcdc2b A G 4: 129,609,629 L270P probably damaging Het
Dennd5b G T 6: 149,036,483 H639N probably damaging Het
Dnah11 T C 12: 118,125,785 E1182G probably damaging Het
Dnah11 T G 12: 118,027,477 T2385P probably benign Het
Dok7 T C 5: 35,066,471 V81A probably damaging Het
Dtx1 T A 5: 120,682,393 M494L possibly damaging Het
Foxj1 A T 11: 116,332,254 L241Q possibly damaging Het
Gbp10 G A 5: 105,236,149 probably benign Het
Hnmt T A 2: 24,003,880 T201S probably benign Het
Jup G T 11: 100,378,351 T412K possibly damaging Het
Kcnh2 G A 5: 24,322,059 S954F probably damaging Het
Klhdc7b A C 15: 89,388,644 K585T possibly damaging Het
Klk7 T A 7: 43,812,000 S14T probably benign Het
Lama4 G A 10: 39,047,948 E451K probably damaging Het
Ldhb A G 6: 142,495,673 C164R probably damaging Het
Malrd1 G A 2: 15,610,090 D239N Het
Mgam T A 6: 40,666,854 V572E probably damaging Het
Mrgprb2 G T 7: 48,552,142 N278K probably damaging Het
Msto1 A G 3: 88,911,823 Y206H probably damaging Het
Myo6 A G 9: 80,262,291 S467G unknown Het
Mysm1 T A 4: 94,961,727 I447L probably benign Het
Nav3 T C 10: 109,852,934 E494G possibly damaging Het
Nol10 T G 12: 17,402,173 V376G probably damaging Het
Nup205 T A 6: 35,214,676 I1032N probably damaging Het
Olfr1002 T A 2: 85,647,424 D299V possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr1170 A T 2: 88,225,022 Y3* probably null Het
Olfr1450 A G 19: 12,954,447 N286S probably damaging Het
Olfr449 T G 6: 42,838,746 Y288* probably null Het
Olfr455 A G 6: 42,538,728 F98S possibly damaging Het
Olfr617 A T 7: 103,584,381 I120L possibly damaging Het
Olfr782 A T 10: 129,350,557 probably benign Het
Olfr996 A G 2: 85,579,296 D19G probably benign Het
Oog2 A G 4: 144,195,281 K254E probably benign Het
Osbpl11 T A 16: 33,236,279 D694E probably benign Het
Pcm1 T A 8: 41,293,510 Y1210N probably benign Het
Pdxk T C 10: 78,440,863 M293V probably benign Het
Plcb3 T C 19: 6,962,867 I451V probably benign Het
Plekhm2 A G 4: 141,634,376 F272S probably damaging Het
Ptgdr A T 14: 44,858,232 probably null Het
Ptprf C T 4: 118,226,523 V788I probably benign Het
Ralbp1 C T 17: 65,854,148 V467I probably benign Het
Ralgds A C 2: 28,543,655 Q229P possibly damaging Het
Recql T C 6: 142,374,884 D146G probably damaging Het
Reln T C 5: 22,051,367 N493S probably damaging Het
Scn5a A T 9: 119,486,530 M1704K probably damaging Het
Slc7a7 G T 14: 54,374,268 A316E possibly damaging Het
Slco1a6 A T 6: 142,091,068 C538S probably benign Het
Spert A G 14: 75,592,637 S39P probably benign Het
Stard6 T C 18: 70,498,647 probably null Het
Strip2 T A 6: 29,927,613 M219K possibly damaging Het
Tcam1 T C 11: 106,284,085 V122A probably damaging Het
Tha1 A G 11: 117,869,690 V236A possibly damaging Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tnc T C 4: 64,020,657 probably benign Het
Vmn1r42 T C 6: 89,845,513 T25A probably benign Het
Vmn2r94 T A 17: 18,244,503 probably null Het
Wdfy4 A C 14: 33,068,906 V2188G Het
Zfp623 T C 15: 75,947,398 S68P probably damaging Het
Zfp950 A T 19: 61,119,155 C497S probably damaging Het
Zkscan2 C T 7: 123,480,104 E877K probably damaging Het
Zp3r C A 1: 130,577,053 V536L probably damaging Het
Other mutations in Rfxank
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1576:Rfxank UTSW 8 70134303 missense possibly damaging 0.95
R4303:Rfxank UTSW 8 70136212 missense probably damaging 1.00
R7033:Rfxank UTSW 8 70138170 missense probably benign
R7355:Rfxank UTSW 8 70135307 missense probably damaging 1.00
R7385:Rfxank UTSW 8 70134635 missense probably damaging 1.00
R8218:Rfxank UTSW 8 70131435 splice site probably null
R8377:Rfxank UTSW 8 70135310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAGCAACCTCACGATGTC -3'
(R):5'- GTGTAATGTTCCCCTTCATGTGAC -3'

Sequencing Primer
(F):5'- GATGTCCGTGTAGCCACCCATAC -3'
(R):5'- TCATGTGACCCCTGAACCC -3'
Posted On2019-11-18