Incidental Mutation 'R7399:Ptgdr'
ID 596117
Institutional Source Beutler Lab
Gene Symbol Ptgdr
Ensembl Gene ENSMUSG00000071489
Gene Name prostaglandin D receptor
Synonyms DP
MMRRC Submission 045481-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7399 (G1)
Quality Score 69.0074
Status Validated
Chromosome 14
Chromosomal Location 45088692-45096832 bp(-) (GRCm39)
Type of Mutation splice site (179 bp from exon)
DNA Base Change (assembly) A to T at 45095689 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000093653 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095959]
AlphaFold P70263
Predicted Effect probably null
Transcript: ENSMUST00000095959
SMART Domains Protein: ENSMUSP00000093653
Gene: ENSMUSG00000071489

DomainStartEndE-ValueType
low complexity region 22 46 N/A INTRINSIC
Pfam:7tm_1 54 319 1.1e-18 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor (GPCR) superfamily. The receptors are seven-pass transmembrane proteins that respond to extracellular cues and activate intracellular signal transduction pathways. This protein is reported to be a receptor for prostaglandin D2, which is a mediator of allergic inflammation and allergic airway inflammation in asthma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a reduced inflammatory response to airborn allergens and reduced susceptibility to passive cutaneous anaphylaxis induced by IgE antigen challenge due to impaired mast cell degranulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T G 11: 84,151,505 (GRCm39) V801G possibly damaging Het
Actbl2 T A 13: 111,392,127 (GRCm39) M154K probably benign Het
Adam7 A T 14: 68,741,915 (GRCm39) probably null Het
Arfgef1 T A 1: 10,251,122 (GRCm39) T888S probably benign Het
AW554918 C T 18: 25,302,117 (GRCm39) P10L possibly damaging Het
Bcap29 A G 12: 31,680,881 (GRCm39) I35T probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Cby2 A G 14: 75,830,077 (GRCm39) S39P probably benign Het
Cdc25b A G 2: 131,036,574 (GRCm39) D458G probably damaging Het
Cdc42bpb T C 12: 111,272,101 (GRCm39) K1104R probably benign Het
Cep89 A G 7: 35,137,803 (GRCm39) N729S probably damaging Het
Clec4a4 T A 6: 122,968,788 (GRCm39) M51K possibly damaging Het
Dcdc2b A G 4: 129,503,422 (GRCm39) L270P probably damaging Het
Dennd5b G T 6: 148,937,981 (GRCm39) H639N probably damaging Het
Dnah11 T G 12: 117,991,212 (GRCm39) T2385P probably benign Het
Dnah11 T C 12: 118,089,520 (GRCm39) E1182G probably damaging Het
Dok7 T C 5: 35,223,815 (GRCm39) V81A probably damaging Het
Dtx1 T A 5: 120,820,458 (GRCm39) M494L possibly damaging Het
Foxj1 A T 11: 116,223,080 (GRCm39) L241Q possibly damaging Het
Gbp10 G A 5: 105,384,015 (GRCm39) probably benign Het
Hnmt T A 2: 23,893,892 (GRCm39) T201S probably benign Het
Jup G T 11: 100,269,177 (GRCm39) T412K possibly damaging Het
Kcnh2 G A 5: 24,527,057 (GRCm39) S954F probably damaging Het
Klhdc7b A C 15: 89,272,847 (GRCm39) K585T possibly damaging Het
Klk7 T A 7: 43,461,424 (GRCm39) S14T probably benign Het
Lama4 G A 10: 38,923,944 (GRCm39) E451K probably damaging Het
Ldhb A G 6: 142,441,399 (GRCm39) C164R probably damaging Het
Malrd1 G A 2: 15,614,901 (GRCm39) D239N Het
Mgam T A 6: 40,643,788 (GRCm39) V572E probably damaging Het
Mrgprb2 G T 7: 48,201,890 (GRCm39) N278K probably damaging Het
Msto1 A G 3: 88,819,130 (GRCm39) Y206H probably damaging Het
Myo6 A G 9: 80,169,573 (GRCm39) S467G unknown Het
Mysm1 T A 4: 94,849,964 (GRCm39) I447L probably benign Het
Nav3 T C 10: 109,688,795 (GRCm39) E494G possibly damaging Het
Nol10 T G 12: 17,452,174 (GRCm39) V376G probably damaging Het
Nup205 T A 6: 35,191,611 (GRCm39) I1032N probably damaging Het
Oog2 A G 4: 143,921,851 (GRCm39) K254E probably benign Het
Or10ac1 A G 6: 42,515,662 (GRCm39) F98S possibly damaging Het
Or52z12 A T 7: 103,233,588 (GRCm39) I120L possibly damaging Het
Or5b98 A G 19: 12,931,811 (GRCm39) N286S probably damaging Het
Or5d41 A T 2: 88,055,366 (GRCm39) Y3* probably null Het
Or5g25 T A 2: 85,477,768 (GRCm39) D299V possibly damaging Het
Or5g27 A G 2: 85,409,640 (GRCm39) D19G probably benign Het
Or6b1 T G 6: 42,815,680 (GRCm39) Y288* probably null Het
Or6c6 A T 10: 129,186,426 (GRCm39) probably benign Het
Or8h10 G A 2: 86,808,501 (GRCm39) T213I probably benign Het
Osbpl11 T A 16: 33,056,649 (GRCm39) D694E probably benign Het
Pcm1 T A 8: 41,746,547 (GRCm39) Y1210N probably benign Het
Pdxk T C 10: 78,276,697 (GRCm39) M293V probably benign Het
Plcb3 T C 19: 6,940,235 (GRCm39) I451V probably benign Het
Plekhm2 A G 4: 141,361,687 (GRCm39) F272S probably damaging Het
Pramel32 C A 4: 88,546,202 (GRCm39) R380L probably benign Het
Ptprf C T 4: 118,083,720 (GRCm39) V788I probably benign Het
Ralbp1 C T 17: 66,161,143 (GRCm39) V467I probably benign Het
Ralgds A C 2: 28,433,667 (GRCm39) Q229P possibly damaging Het
Recql T C 6: 142,320,610 (GRCm39) D146G probably damaging Het
Reln T C 5: 22,256,365 (GRCm39) N493S probably damaging Het
Rfxank C T 8: 70,587,936 (GRCm39) probably null Het
Scn5a A T 9: 119,315,596 (GRCm39) M1704K probably damaging Het
Slc7a7 G T 14: 54,611,725 (GRCm39) A316E possibly damaging Het
Slco1a6 A T 6: 142,036,794 (GRCm39) C538S probably benign Het
Stard6 T C 18: 70,631,718 (GRCm39) probably null Het
Strip2 T A 6: 29,927,612 (GRCm39) M219K possibly damaging Het
Tcam1 T C 11: 106,174,911 (GRCm39) V122A probably damaging Het
Tha1 A G 11: 117,760,516 (GRCm39) V236A possibly damaging Het
Tmem201 A T 4: 149,815,554 (GRCm39) I132N possibly damaging Het
Tnc T C 4: 63,938,894 (GRCm39) probably benign Het
Vmn1r42 T C 6: 89,822,495 (GRCm39) T25A probably benign Het
Vmn2r94 T A 17: 18,464,765 (GRCm39) probably null Het
Wdfy4 A C 14: 32,790,863 (GRCm39) V2188G Het
Zfp623 T C 15: 75,819,247 (GRCm39) S68P probably damaging Het
Zfp950 A T 19: 61,107,593 (GRCm39) C497S probably damaging Het
Zkscan2 C T 7: 123,079,327 (GRCm39) E877K probably damaging Het
Zp3r C A 1: 130,504,790 (GRCm39) V536L probably damaging Het
Other mutations in Ptgdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Ptgdr APN 14 45,096,071 (GRCm39) missense probably damaging 1.00
R1036:Ptgdr UTSW 14 45,096,572 (GRCm39) missense probably damaging 0.98
R1368:Ptgdr UTSW 14 45,090,799 (GRCm39) missense probably damaging 1.00
R1649:Ptgdr UTSW 14 45,095,959 (GRCm39) missense probably benign
R1785:Ptgdr UTSW 14 45,096,036 (GRCm39) nonsense probably null
R1786:Ptgdr UTSW 14 45,096,036 (GRCm39) nonsense probably null
R1921:Ptgdr UTSW 14 45,090,738 (GRCm39) missense probably benign 0.00
R2312:Ptgdr UTSW 14 45,096,619 (GRCm39) missense probably damaging 1.00
R4867:Ptgdr UTSW 14 45,096,253 (GRCm39) missense probably damaging 1.00
R5198:Ptgdr UTSW 14 45,096,300 (GRCm39) missense probably damaging 1.00
R6917:Ptgdr UTSW 14 45,096,067 (GRCm39) missense possibly damaging 0.81
R7186:Ptgdr UTSW 14 45,096,401 (GRCm39) missense probably damaging 1.00
R7291:Ptgdr UTSW 14 45,096,649 (GRCm39) missense possibly damaging 0.69
R7612:Ptgdr UTSW 14 45,096,094 (GRCm39) missense probably damaging 0.98
R7763:Ptgdr UTSW 14 45,096,535 (GRCm39) missense probably damaging 0.99
R7850:Ptgdr UTSW 14 45,090,828 (GRCm39) missense probably benign 0.05
R8139:Ptgdr UTSW 14 45,096,142 (GRCm39) missense probably benign 0.13
R8262:Ptgdr UTSW 14 45,090,858 (GRCm39) missense probably benign 0.01
R8392:Ptgdr UTSW 14 45,096,379 (GRCm39) missense probably damaging 1.00
R8992:Ptgdr UTSW 14 45,096,181 (GRCm39) missense probably damaging 1.00
R9359:Ptgdr UTSW 14 45,090,715 (GRCm39) missense
R9403:Ptgdr UTSW 14 45,090,715 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- TGTGCCCTGGTGAGGAAATAG -3'
(R):5'- CTCATGACAGTGCTCTTCACCATG -3'

Sequencing Primer
(F):5'- TAGAGAACTAAGGTCTAGAGCACAC -3'
(R):5'- GACAGTGCTCTTCACCATGTGTTC -3'
Posted On 2019-11-18