Incidental Mutation 'R0242:Odad2'
ID 59613
Institutional Source Beutler Lab
Gene Symbol Odad2
Ensembl Gene ENSMUSG00000061802
Gene Name outer dynein arm docking complex subunit 2
Synonyms b2b227.1Clo, Armc4, b2b643Clo, 4930463I21Rik
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.399) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 7088209-7297936 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 7211516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 786 (V786D)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
AlphaFold B2RY50
Predicted Effect probably damaging
Transcript: ENSMUST00000081275
AA Change: V786D

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: V786D

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Meta Mutation Damage Score 0.4762 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Odad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Odad2 APN 18 7,211,504 (GRCm39) missense probably damaging 0.96
IGL00822:Odad2 APN 18 7,181,817 (GRCm39) missense probably damaging 1.00
IGL01345:Odad2 APN 18 7,266,947 (GRCm39) missense probably benign 0.00
IGL01593:Odad2 APN 18 7,127,345 (GRCm39) missense probably benign 0.00
IGL01645:Odad2 APN 18 7,268,491 (GRCm39) missense probably benign 0.00
IGL01863:Odad2 APN 18 7,222,617 (GRCm39) missense probably damaging 1.00
IGL01955:Odad2 APN 18 7,127,291 (GRCm39) missense possibly damaging 0.89
IGL02013:Odad2 APN 18 7,265,157 (GRCm39) splice site probably benign
IGL02142:Odad2 APN 18 7,214,601 (GRCm39) missense probably damaging 1.00
IGL02399:Odad2 APN 18 7,285,719 (GRCm39) missense probably benign
IGL02439:Odad2 APN 18 7,268,444 (GRCm39) missense probably benign 0.04
IGL02452:Odad2 APN 18 7,129,461 (GRCm39) missense probably damaging 1.00
IGL02632:Odad2 APN 18 7,214,727 (GRCm39) splice site probably benign
IGL03344:Odad2 APN 18 7,129,434 (GRCm39) nonsense probably null
R0062:Odad2 UTSW 18 7,129,593 (GRCm39) splice site probably benign
R0062:Odad2 UTSW 18 7,129,593 (GRCm39) splice site probably benign
R0242:Odad2 UTSW 18 7,211,516 (GRCm39) missense probably damaging 0.96
R0365:Odad2 UTSW 18 7,217,800 (GRCm39) missense probably benign 0.01
R0377:Odad2 UTSW 18 7,127,415 (GRCm39) missense probably benign 0.04
R0466:Odad2 UTSW 18 7,286,758 (GRCm39) missense probably benign 0.10
R0517:Odad2 UTSW 18 7,223,621 (GRCm39) missense probably damaging 1.00
R0521:Odad2 UTSW 18 7,222,676 (GRCm39) missense possibly damaging 0.64
R0841:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1145:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1145:Odad2 UTSW 18 7,268,436 (GRCm39) missense probably damaging 0.99
R1435:Odad2 UTSW 18 7,222,646 (GRCm39) missense probably benign 0.01
R1487:Odad2 UTSW 18 7,273,245 (GRCm39) missense probably damaging 0.98
R1634:Odad2 UTSW 18 7,286,688 (GRCm39) missense probably damaging 0.99
R1677:Odad2 UTSW 18 7,222,554 (GRCm39) missense probably benign 0.01
R1778:Odad2 UTSW 18 7,127,388 (GRCm39) missense probably damaging 1.00
R1792:Odad2 UTSW 18 7,286,743 (GRCm39) missense probably benign 0.00
R1809:Odad2 UTSW 18 7,211,630 (GRCm39) missense probably benign 0.08
R1842:Odad2 UTSW 18 7,223,551 (GRCm39) missense probably benign 0.04
R2144:Odad2 UTSW 18 7,127,229 (GRCm39) missense probably damaging 0.96
R2206:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2273:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2275:Odad2 UTSW 18 7,223,676 (GRCm39) missense probably benign 0.25
R2918:Odad2 UTSW 18 7,222,625 (GRCm39) missense probably benign 0.04
R3421:Odad2 UTSW 18 7,223,523 (GRCm39) splice site probably benign
R3422:Odad2 UTSW 18 7,223,523 (GRCm39) splice site probably benign
R4165:Odad2 UTSW 18 7,217,008 (GRCm39) missense probably damaging 1.00
R4225:Odad2 UTSW 18 7,181,732 (GRCm39) critical splice donor site probably null
R4660:Odad2 UTSW 18 7,211,609 (GRCm39) missense possibly damaging 0.88
R4745:Odad2 UTSW 18 7,286,763 (GRCm39) missense probably benign 0.28
R4812:Odad2 UTSW 18 7,288,634 (GRCm39) missense possibly damaging 0.79
R4831:Odad2 UTSW 18 7,222,564 (GRCm39) missense possibly damaging 0.79
R4923:Odad2 UTSW 18 7,181,787 (GRCm39) missense probably damaging 0.97
R4995:Odad2 UTSW 18 7,223,663 (GRCm39) missense probably damaging 1.00
R5024:Odad2 UTSW 18 7,088,555 (GRCm39) missense probably benign 0.02
R5335:Odad2 UTSW 18 7,294,566 (GRCm39) missense probably benign 0.06
R5434:Odad2 UTSW 18 7,222,550 (GRCm39) missense probably benign 0.03
R5552:Odad2 UTSW 18 7,285,360 (GRCm39) missense possibly damaging 0.51
R5719:Odad2 UTSW 18 7,211,496 (GRCm39) missense probably benign 0.00
R5736:Odad2 UTSW 18 7,268,416 (GRCm39) missense probably benign 0.01
R5792:Odad2 UTSW 18 7,217,965 (GRCm39) missense probably benign 0.00
R5848:Odad2 UTSW 18 7,268,507 (GRCm39) splice site probably null
R5957:Odad2 UTSW 18 7,285,706 (GRCm39) missense probably benign 0.01
R6001:Odad2 UTSW 18 7,286,838 (GRCm39) missense probably benign 0.03
R6309:Odad2 UTSW 18 7,214,617 (GRCm39) missense probably benign 0.04
R6559:Odad2 UTSW 18 7,223,664 (GRCm39) missense probably damaging 0.99
R6574:Odad2 UTSW 18 7,129,394 (GRCm39) splice site probably null
R6581:Odad2 UTSW 18 7,129,560 (GRCm39) missense possibly damaging 0.77
R6736:Odad2 UTSW 18 7,223,586 (GRCm39) missense probably damaging 0.98
R6842:Odad2 UTSW 18 7,268,401 (GRCm39) missense probably benign 0.00
R6968:Odad2 UTSW 18 7,273,155 (GRCm39) splice site probably null
R6974:Odad2 UTSW 18 7,294,479 (GRCm39) missense probably benign 0.37
R7024:Odad2 UTSW 18 7,211,593 (GRCm39) missense probably benign 0.43
R7299:Odad2 UTSW 18 7,222,635 (GRCm39) missense probably damaging 1.00
R7578:Odad2 UTSW 18 7,211,593 (GRCm39) missense probably benign 0.43
R7737:Odad2 UTSW 18 7,217,890 (GRCm39) missense probably damaging 1.00
R7878:Odad2 UTSW 18 7,217,801 (GRCm39) missense probably benign 0.01
R8025:Odad2 UTSW 18 7,127,224 (GRCm39) missense probably benign 0.43
R8151:Odad2 UTSW 18 7,127,358 (GRCm39) missense probably damaging 1.00
R8989:Odad2 UTSW 18 7,268,464 (GRCm39) missense probably benign 0.24
R8998:Odad2 UTSW 18 7,211,574 (GRCm39) missense possibly damaging 0.79
R8999:Odad2 UTSW 18 7,211,574 (GRCm39) missense possibly damaging 0.79
R9006:Odad2 UTSW 18 7,294,516 (GRCm39) missense probably benign 0.00
R9091:Odad2 UTSW 18 7,217,846 (GRCm39) nonsense probably null
R9106:Odad2 UTSW 18 7,294,527 (GRCm39) missense probably benign 0.18
R9153:Odad2 UTSW 18 7,286,733 (GRCm39) missense possibly damaging 0.81
R9229:Odad2 UTSW 18 7,127,324 (GRCm39) missense possibly damaging 0.53
R9254:Odad2 UTSW 18 7,265,089 (GRCm39) missense possibly damaging 0.94
R9270:Odad2 UTSW 18 7,217,846 (GRCm39) nonsense probably null
R9379:Odad2 UTSW 18 7,265,089 (GRCm39) missense possibly damaging 0.94
R9626:Odad2 UTSW 18 7,211,422 (GRCm39) nonsense probably null
R9708:Odad2 UTSW 18 7,288,633 (GRCm39) missense probably benign 0.02
Z1088:Odad2 UTSW 18 7,266,919 (GRCm39) missense probably benign
Z1176:Odad2 UTSW 18 7,216,973 (GRCm39) nonsense probably null
Z1176:Odad2 UTSW 18 7,129,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACACAGGACCACTTCTCTTTCAAGAT -3'
(R):5'- TGATCAAGAACATAGGTAGGTTGCAGGT -3'

Sequencing Primer
(F):5'- GGCTAGGCAAGTCATAATATTCACG -3'
(R):5'- TGAAGGTTAAATGGGTCTACTCAG -3'
Posted On 2013-07-11