Mutagenetix > Incidental Mutation

Incidental Mutation 'R7375:Psme4'

596139

Institutional Source

Beutler Lab

Gene Symbol

Psme4

Ensembl Gene

ENSMUSG00000040850

Gene Name

proteasome (prosome, macropain) activator subunit 4

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_134013

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7375 (G1)

Quality Score

107.008

Status

Validated

Chromosome

Chromosomal Location

30771726-30880361 bp(+) (GRCm38)

Type of Mutation

splice site (113 bp from exon)

DNA Base Change (assembly)

T to A at 30772700 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041231]

AlphaFold

Q5SSW2

Predicted Effect

probably benign
Transcript: ENSMUST00000041231

SMART Domains

Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	122	133	N/A	INTRINSIC
Pfam:BLM10_mid	330	828	8.8e-119	PFAM
SCOP:d1b3ua_	1183	1716	3e-14	SMART
Pfam:DUF3437	1756	1843	5.3e-39	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000154757

SMART Domains

Protein: ENSMUSP00000119133
Gene: ENSMUSG00000040850

Domain	Start	End	E-Value	Type
low complexity region	131	142	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,918,671	I337V	probably benign	Het
Abl2	A	G	1: 156,622,614	D117G	probably damaging	Het
Arhgap5	T	A	12: 52,516,582	L112*	probably null	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Cmya5	T	G	13: 93,091,661	K2306N	probably damaging	Het
Col16a1	A	C	4: 130,065,501	K680T	unknown	Het
Col28a1	T	A	6: 7,998,499	T1137S	possibly damaging	Het
Crnn	A	T	3: 93,149,145	T413S	possibly damaging	Het
Csf1	A	G	3: 107,748,179	L512P	possibly damaging	Het
Dlx3	C	A	11: 95,120,635	A105D	possibly damaging	Het
Dnah3	T	G	7: 119,951,677	T161P	probably damaging	Het
Dnah7b	A	G	1: 46,303,634	D3435G	probably damaging	Het
Dpp10	A	G	1: 123,367,795	I541T	probably benign	Het
Efcc1	T	C	6: 87,751,856	V431A	possibly damaging	Het
Enpp5	T	C	17: 44,080,977	I99T	probably benign	Het
Fam192a	G	A	8: 94,583,008	L119F	probably benign	Het
Gm11232	C	T	4: 71,757,346	W59*	probably null	Het
Gm17660	G	T	5: 104,071,257		probably null	Het
Gm8251	A	T	1: 44,060,534	I468N	possibly damaging	Het
Gxylt2	A	T	6: 100,750,422	T166S	probably benign	Het
Herc6	A	T	6: 57,651,806		probably null	Het
Itga2	T	C	13: 114,869,217	I476V	probably benign	Het
Kcnq5	T	C	1: 21,469,486	T403A	possibly damaging	Het
Klhl42	A	G	6: 147,092,040	K170R	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Krt32	G	T	11: 100,081,224	R433S	probably benign	Het
Lrp1	G	T	10: 127,539,348	T4461N	probably damaging	Het
Maats1	T	A	16: 38,335,618	H81L	probably damaging	Het
Mapk10	A	T	5: 102,976,390	M256K	probably null	Het
Mogat2	T	C	7: 99,223,698	K93R	probably damaging	Het
Myh1	G	T	11: 67,210,428	V677L	probably damaging	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Olfr1242	C	T	2: 89,493,692	G207R	possibly damaging	Het
Oog4	G	A	4: 143,438,974	T201M	possibly damaging	Het
Pik3c2a	T	C	7: 116,376,386	T649A	probably damaging	Het
Plec	T	A	15: 76,177,355	H2794L	possibly damaging	Het
Pros1	T	A	16: 62,924,550	N509K	probably damaging	Het
Ptprf	A	G	4: 118,212,814	V1457A	probably benign	Het
Rad50	A	G	11: 53,652,228		probably null	Het
Rfx5	C	T	3: 94,958,742	P451S	unknown	Het
Sdk1	G	T	5: 141,998,843	V728L	probably benign	Het
Sfxn4	T	C	19: 60,858,674	D57G	probably benign	Het
Slc10a4	A	G	5: 73,012,307	D425G	probably benign	Het
Slc17a5	C	T	9: 78,587,892	A26T	probably benign	Het
Slc22a26	A	T	19: 7,783,144		probably null	Het
Slc22a30	A	G	19: 8,404,691	L72P	probably damaging	Het
Slco6c1	T	C	1: 97,081,421	T447A	possibly damaging	Het
Slco6d1	A	G	1: 98,421,447	N81S	probably damaging	Het
Stard9	T	C	2: 120,665,002		probably null	Het
Tecpr1	T	C	5: 144,208,599	E610G	possibly damaging	Het
Tmem81	G	T	1: 132,507,563	V36L	possibly damaging	Het
Trabd2b	G	T	4: 114,609,997	K474N	probably benign	Het
Tspan33	T	C	6: 29,713,520	F149L	probably benign	Het
Ttn	A	G	2: 76,776,339	Y18076H	probably damaging	Het
Utrn	G	A	10: 12,641,020	R2277C	probably damaging	Het
Vmn2r101	T	A	17: 19,611,390	D549E	probably damaging	Het
Vmn2r107	T	A	17: 20,355,876	I156K	probably benign	Het
Wwc2	T	G	8: 47,863,920	S713R	unknown	Het
Xndc1	C	A	7: 102,081,480		probably null	Het
Zfp810	A	G	9: 22,290,537		probably null	Het

Other mutations in Psme4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Psme4	APN	11	30815710	critical splice donor site	probably null
IGL00401:Psme4	APN	11	30821079	splice site	probably benign
IGL00475:Psme4	APN	11	30845252	missense	probably benign	0.14
IGL00576:Psme4	APN	11	30823145	missense	possibly damaging	0.50
IGL00817:Psme4	APN	11	30820129	missense	probably benign	0.01
IGL01525:Psme4	APN	11	30809936	splice site	probably benign
IGL01862:Psme4	APN	11	30812038	nonsense	probably null
IGL02310:Psme4	APN	11	30837484	missense	probably benign	0.06
IGL02477:Psme4	APN	11	30842083	missense	probably damaging	0.99
IGL02545:Psme4	APN	11	30841586	missense	possibly damaging	0.81
IGL02608:Psme4	APN	11	30820944	missense	probably benign	0.34
IGL02621:Psme4	APN	11	30848131	missense	probably benign
IGL02822:Psme4	APN	11	30848204	unclassified	probably benign
IGL02833:Psme4	APN	11	30850715	unclassified	probably benign
IGL02964:Psme4	APN	11	30791095	nonsense	probably null
IGL03273:Psme4	APN	11	30848130	missense	probably damaging	1.00
IGL03348:Psme4	APN	11	30876796	missense	probably damaging	1.00
IGL03382:Psme4	APN	11	30807788	missense	possibly damaging	0.94
H2330:Psme4	UTSW	11	30851210	missense	probably benign	0.17
PIT4378001:Psme4	UTSW	11	30821079	splice site	probably benign
R0276:Psme4	UTSW	11	30811980	missense	probably damaging	1.00
R0462:Psme4	UTSW	11	30848117	missense	probably damaging	1.00
R0685:Psme4	UTSW	11	30878415	missense	probably damaging	1.00
R0766:Psme4	UTSW	11	30807687	splice site	probably null
R0830:Psme4	UTSW	11	30807797	missense	possibly damaging	0.53
R0940:Psme4	UTSW	11	30815264	missense	possibly damaging	0.53
R1018:Psme4	UTSW	11	30804310	missense	probably damaging	1.00
R1312:Psme4	UTSW	11	30807687	splice site	probably null
R1448:Psme4	UTSW	11	30852744	missense	probably damaging	1.00
R1713:Psme4	UTSW	11	30806310	missense	probably damaging	1.00
R1732:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R1813:Psme4	UTSW	11	30804353	missense	probably benign	0.14
R1905:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1907:Psme4	UTSW	11	30810922	missense	probably damaging	1.00
R1911:Psme4	UTSW	11	30815658	missense	probably benign	0.02
R1956:Psme4	UTSW	11	30832424	missense	probably damaging	0.99
R1974:Psme4	UTSW	11	30819011	missense	probably benign	0.00
R1980:Psme4	UTSW	11	30832615	missense	possibly damaging	0.84
R1986:Psme4	UTSW	11	30830352	missense	probably benign	0.01
R2046:Psme4	UTSW	11	30817723	splice site	probably benign
R2142:Psme4	UTSW	11	30820998	missense	possibly damaging	0.89
R2698:Psme4	UTSW	11	30874282	critical splice donor site	probably null
R2844:Psme4	UTSW	11	30845173	splice site	probably benign
R3807:Psme4	UTSW	11	30856027	splice site	probably null
R3876:Psme4	UTSW	11	30856068	missense	probably damaging	0.99
R4420:Psme4	UTSW	11	30812028	missense	possibly damaging	0.67
R4584:Psme4	UTSW	11	30834318	missense	probably damaging	1.00
R4615:Psme4	UTSW	11	30834287	missense	probably benign	0.02
R4714:Psme4	UTSW	11	30832573	missense	probably benign	0.02
R5008:Psme4	UTSW	11	30856896	intron	probably benign
R5109:Psme4	UTSW	11	30791095	nonsense	probably null
R5155:Psme4	UTSW	11	30876806	missense	probably damaging	1.00
R5199:Psme4	UTSW	11	30853272	missense	probably benign	0.00
R5205:Psme4	UTSW	11	30832666	intron	probably benign
R5452:Psme4	UTSW	11	30791168	missense	probably benign
R5491:Psme4	UTSW	11	30815246	missense	possibly damaging	0.63
R5685:Psme4	UTSW	11	30809837	missense	probably damaging	0.99
R5764:Psme4	UTSW	11	30772364	intron	probably benign
R5853:Psme4	UTSW	11	30791234	critical splice donor site	probably null
R5865:Psme4	UTSW	11	30791993	missense	possibly damaging	0.95
R5903:Psme4	UTSW	11	30841589	missense	probably benign	0.28
R5927:Psme4	UTSW	11	30804294	missense	possibly damaging	0.82
R6004:Psme4	UTSW	11	30856896	intron	probably benign
R6102:Psme4	UTSW	11	30865567	missense	probably damaging	1.00
R6247:Psme4	UTSW	11	30853245	missense	possibly damaging	0.60
R6527:Psme4	UTSW	11	30832175	missense	probably benign
R6750:Psme4	UTSW	11	30853203	missense	probably damaging	1.00
R6885:Psme4	UTSW	11	30834307	nonsense	probably null
R6939:Psme4	UTSW	11	30837291	missense	probably damaging	0.99
R6945:Psme4	UTSW	11	30837437	missense	probably benign	0.06
R7029:Psme4	UTSW	11	30772474	intron	probably benign
R7049:Psme4	UTSW	11	30813904	splice site	probably null
R7098:Psme4	UTSW	11	30850661	missense	probably damaging	0.99
R7107:Psme4	UTSW	11	30848105	missense	probably benign	0.03
R7223:Psme4	UTSW	11	30874226	missense	probably benign	0.33
R7319:Psme4	UTSW	11	30807790	missense	probably benign	0.00
R7410:Psme4	UTSW	11	30815279	nonsense	probably null
R7469:Psme4	UTSW	11	30802837	missense	probably benign	0.20
R7651:Psme4	UTSW	11	30837334	missense	probably damaging	0.98
R7679:Psme4	UTSW	11	30878425	missense	probably damaging	0.99
R7681:Psme4	UTSW	11	30791975	missense	possibly damaging	0.63
R7822:Psme4	UTSW	11	30874245	missense	probably benign
R8013:Psme4	UTSW	11	30804320	missense	probably benign	0.06
R8130:Psme4	UTSW	11	30842026	missense	probably damaging	1.00
R8323:Psme4	UTSW	11	30843532	missense	probably damaging	0.99
R8330:Psme4	UTSW	11	30843583	missense	probably benign	0.00
R8363:Psme4	UTSW	11	30812139	missense	probably damaging	1.00
R8491:Psme4	UTSW	11	30772161	missense	possibly damaging	0.90
R8690:Psme4	UTSW	11	30837319	missense	probably benign	0.00
R8696:Psme4	UTSW	11	30809896	missense	probably damaging	0.99
R8743:Psme4	UTSW	11	30878467	missense	probably damaging	1.00
R8998:Psme4	UTSW	11	30838957	missense	possibly damaging	0.78
R9241:Psme4	UTSW	11	30865576	missense	probably damaging	1.00
R9657:Psme4	UTSW	11	30838980	missense	probably benign	0.00
R9736:Psme4	UTSW	11	30847411	missense	probably damaging	0.99
R9744:Psme4	UTSW	11	30815294	critical splice donor site	probably null
R9746:Psme4	UTSW	11	30876868	nonsense	probably null
V5088:Psme4	UTSW	11	30851210	missense	probably benign	0.17
X0063:Psme4	UTSW	11	30832600	missense	possibly damaging	0.66
Z1176:Psme4	UTSW	11	30843522	missense	possibly damaging	0.87
Z1177:Psme4	UTSW	11	30806311	missense	probably damaging	1.00
Z1177:Psme4	UTSW	11	30812138	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTTTCTCTTGACGTGCCAGG -3'
(R):5'- GTCGTGACCGAGGAAATGTC -3'

Sequencing Primer
(F):5'- TCTTGACGTGCCAGGCTCTG -3'
(R):5'- TGTCACAACAGGAACATACACTTTTC -3'

Posted On

2019-11-21