Mutagenetix > Incidental Mutation

Incidental Mutation 'R0242:Asxl3'

59614

Institutional Source

Beutler Lab

Gene Symbol

Asxl3

Ensembl Gene

ENSMUSG00000045215

Gene Name

additional sex combs like 3, transcriptional regulator

Synonyms

D930044O18Rik, LOC381127, C230079D11Rik, D430002O22Rik

MMRRC Submission

038480-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.347) question?

Stock #

R0242 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

22344883-22530227 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 22516681 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 576 (E576K)

Ref Sequence

ENSEMBL: ENSMUSP00000112793 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097655] [ENSMUST00000120223]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000097655
AA Change: E576K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000095260
Gene: ENSMUSG00000045215
AA Change: E576K

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	173	305	5.6e-50	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2139	2202	9.8e-28	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120223
AA Change: E576K

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000112793
Gene: ENSMUSG00000045215
AA Change: E576K

Domain	Start	End	E-Value	Type
low complexity region	98	112	N/A	INTRINSIC
Pfam:ASXH	179	304	1.3e-36	PFAM
low complexity region	391	404	N/A	INTRINSIC
low complexity region	667	686	N/A	INTRINSIC
low complexity region	939	954	N/A	INTRINSIC
low complexity region	978	988	N/A	INTRINSIC
low complexity region	1002	1023	N/A	INTRINSIC
low complexity region	1160	1168	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1681	1691	N/A	INTRINSIC
SCOP:d1dnpa2	1946	1995	6e-3	SMART
low complexity region	2035	2050	N/A	INTRINSIC
Pfam:PHD_3	2138	2202	1.9e-24	PFAM

Meta Mutation Damage Score

0.0939

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (110/113)

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,676	D230G	probably benign	Het
4930435E12Rik	C	T	16: 38,824,567		probably benign	Het
Abhd13	A	G	8: 9,987,561	I53V	probably benign	Het
Adgrl2	A	C	3: 148,839,185		probably null	Het
Aldh16a1	G	A	7: 45,144,664	A596V	probably damaging	Het
Aldh3b2	T	A	19: 3,979,414	Y262*	probably null	Het
Ambn	A	G	5: 88,467,972	Q420R	possibly damaging	Het
Ankib1	A	C	5: 3,700,344		probably benign	Het
Arhgap9	C	A	10: 127,329,538	H430Q	probably benign	Het
Arhgef25	C	T	10: 127,184,064	G435E	probably damaging	Het
Armc12	A	T	17: 28,532,392	D120V	possibly damaging	Het
Armc4	A	T	18: 7,211,516	V786D	probably damaging	Het
Bcdin3d	T	C	15: 99,470,895	E141G	probably benign	Het
Bmpr1b	G	A	3: 141,840,676	T483M	probably damaging	Het
Caprin2	C	T	6: 148,842,954	S991N	probably damaging	Het
Cd96	T	C	16: 46,071,766	I286M	possibly damaging	Het
Cdcp1	G	T	9: 123,180,172	F480L	probably benign	Het
Celf5	T	C	10: 81,464,409	T258A	probably benign	Het
Cgnl1	A	G	9: 71,721,657	V577A	probably damaging	Het
Clca3b	A	G	3: 144,841,465	S304P	probably benign	Het
Cmya5	A	T	13: 93,095,600	H993Q	probably benign	Het
Cnbp	A	T	6: 87,845,764	C6S	probably damaging	Het
Col14a1	C	T	15: 55,497,511	R1605W	probably damaging	Het
Cops7a	T	C	6: 124,964,854	N11S	probably benign	Het
Coro7	T	C	16: 4,630,178		probably benign	Het
Cpvl	T	C	6: 53,932,500	H217R	possibly damaging	Het
Cuedc1	T	C	11: 88,184,621		probably benign	Het
Cyp2c66	A	G	19: 39,141,925	Y68C	probably damaging	Het
Dicer1	G	A	12: 104,702,451	T1324M	probably benign	Het
Dlgap2	A	G	8: 14,727,562	D268G	probably benign	Het
Dnm1	T	A	2: 32,316,989	M535L	possibly damaging	Het
Dock7	A	T	4: 98,962,280	F1575Y	probably benign	Het
Dpp10	T	A	1: 123,398,546	H403L	possibly damaging	Het
Dync1h1	A	G	12: 110,649,851	D3112G	possibly damaging	Het
Eno3	A	G	11: 70,657,935	E21G	probably null	Het
Fam120b	T	A	17: 15,422,924	V655D	probably damaging	Het
Fam129a	A	G	1: 151,718,216	D884G	probably benign	Het
Fkbp5	A	T	17: 28,428,452	D136E	probably benign	Het
Gdap1l1	T	A	2: 163,447,653	Y179*	probably null	Het
Gfer	A	G	17: 24,694,303	W192R	probably damaging	Het
Gm4782	A	G	6: 50,609,858	T408A	probably benign	Het
Golgb1	C	T	16: 36,875,630	Q164*	probably null	Het
Gpnmb	A	G	6: 49,047,342	N197S	probably damaging	Het
Gtf2f1	G	A	17: 57,003,802	T414M	probably benign	Het
Hc	A	G	2: 35,036,154		probably benign	Het
Hcfc1	A	T	X: 73,948,429		probably benign	Het
Helz2	C	T	2: 181,230,430	R2539Q	probably damaging	Het
Hsd17b12	T	A	2: 94,157,815	I19F	probably benign	Het
Incenp	T	C	19: 9,893,750	T172A	unknown	Het
Jmy	A	G	13: 93,441,618	Y681H	probably benign	Het
Kbtbd11	A	G	8: 15,027,508	T36A	probably benign	Het
Kcnh4	T	C	11: 100,755,699	D267G	probably damaging	Het
Krt34	C	T	11: 100,041,331	E56K	probably damaging	Het
Krt40	T	A	11: 99,538,742	E335D	probably damaging	Het
Krt86	T	A	15: 101,476,573	Y282*	probably null	Het
Lgi3	C	T	14: 70,534,815	R267*	probably null	Het
Lnpk	A	G	2: 74,537,289		probably benign	Het
Lrp1b	T	A	2: 40,998,183	H2355L	probably benign	Het
Lrrc8e	G	A	8: 4,235,401	R542H	probably benign	Het
Mia2	T	C	12: 59,108,856	Y452H	probably damaging	Het
Mmachc	C	T	4: 116,704,541	R132Q	probably damaging	Het
Mtbp	T	A	15: 55,577,486	N356K	possibly damaging	Het
Mum1	T	C	10: 80,234,258	S354P	probably benign	Het
Myo5b	A	G	18: 74,661,716	H552R	possibly damaging	Het
Noxred1	A	G	12: 87,226,979	V96A	probably benign	Het
Nr1d2	T	A	14: 18,211,933	D390V	possibly damaging	Het
Oas1e	A	T	5: 120,791,774		probably benign	Het
Olfr398	T	C	11: 73,983,712	S299G	probably benign	Het
Olfr786	T	A	10: 129,437,348	Y179N	probably damaging	Het
Otog	G	T	7: 46,267,381	C914F	probably damaging	Het
Pank2	G	T	2: 131,280,197	C214F	probably damaging	Het
Pcdhb1	T	A	18: 37,266,735	S580T	probably benign	Het
Pdia3	T	C	2: 121,414,111	S2P	probably damaging	Het
Peli1	G	T	11: 21,142,602	R83L	probably damaging	Het
Pla2g3	T	A	11: 3,491,935	C366*	probably null	Het
Pon3	T	A	6: 5,240,860	D107V	probably benign	Het
Ppip5k2	A	G	1: 97,741,091	C532R	probably damaging	Het
Prph	A	T	15: 99,055,727	D174V	probably damaging	Het
Psd3	A	G	8: 67,758,086	M270T	probably damaging	Het
Pum3	A	G	19: 27,422,755		probably benign	Het
Pus1	A	T	5: 110,779,798	H30Q	probably benign	Het
Rab7	A	T	6: 88,005,132	V87E	probably damaging	Het
Rbm5	A	T	9: 107,751,708		probably benign	Het
Reln	A	G	5: 21,942,597		probably null	Het
S1pr3	A	G	13: 51,418,902	T40A	probably benign	Het
Sdk1	T	A	5: 142,143,922		probably benign	Het
Senp7	T	A	16: 56,179,521	I853N	probably damaging	Het
Serpinb6c	T	A	13: 33,899,247		probably benign	Het
Shroom1	T	G	11: 53,465,485		probably null	Het
Slc24a3	T	C	2: 145,606,664	I376T	probably benign	Het
Slc46a1	T	C	11: 78,468,667	I375T	possibly damaging	Het
Slc4a9	T	C	18: 36,533,680	F527S	probably damaging	Het
Slc4a9	T	A	18: 36,541,233	I924N	probably damaging	Het
Slx4	T	A	16: 3,986,952	E666V	probably damaging	Het
Snrnp27	G	A	6: 86,675,593		probably benign	Het
Sorcs1	C	T	19: 50,228,221	G640E	probably damaging	Het
Sptan1	A	T	2: 30,018,401	M1725L	probably benign	Het
Sync	G	A	4: 129,293,721	R182K	probably damaging	Het
Syne2	G	A	12: 76,098,034	G1586S	probably damaging	Het
Sytl1	G	T	4: 133,253,457	T522K	probably damaging	Het
Tex2	T	A	11: 106,519,955	K414*	probably null	Het
Thegl	G	T	5: 77,016,305	E52*	probably null	Het
Thsd7a	G	A	6: 12,503,916	T413I	probably benign	Het
Tm9sf1	C	T	14: 55,637,935	A451T	possibly damaging	Het
Ttn	A	T	2: 76,826,152		probably benign	Het
Uba2	T	C	7: 34,154,629	I140V	possibly damaging	Het
Ushbp1	C	A	8: 71,390,118	G361*	probably null	Het
Wbp2nl	C	T	15: 82,313,787	A175V	probably benign	Het
Zc3h12d	A	G	10: 7,862,566	E212G	probably damaging	Het
Zc3h7b	T	C	15: 81,768,830		probably benign	Het

Other mutations in Asxl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Asxl3	APN	18	22525223	missense	probably benign	0.41
IGL00510:Asxl3	APN	18	22523565	missense	probably damaging	1.00
IGL00864:Asxl3	APN	18	22522446	missense	probably benign	0.06
IGL01074:Asxl3	APN	18	22522845	missense	probably damaging	1.00
IGL01305:Asxl3	APN	18	22516446	missense	probably benign	0.06
IGL01313:Asxl3	APN	18	22517459	missense	probably benign	0.41
IGL01349:Asxl3	APN	18	22524237	missense	probably benign	0.28
IGL01529:Asxl3	APN	18	22517655	missense	probably damaging	1.00
IGL01574:Asxl3	APN	18	22523564	missense	probably benign	0.06
IGL01583:Asxl3	APN	18	22516597	missense	probably benign	0.01
IGL01619:Asxl3	APN	18	22523328	missense	probably damaging	1.00
IGL01720:Asxl3	APN	18	22525325	missense	probably damaging	1.00
IGL01816:Asxl3	APN	18	22522488	missense	probably benign	0.10
IGL01828:Asxl3	APN	18	22525558	utr 3 prime	probably benign
IGL01903:Asxl3	APN	18	22434576	missense	probably benign	0.00
IGL01906:Asxl3	APN	18	22522281	missense	probably benign	0.01
IGL01962:Asxl3	APN	18	22522445	missense	probably benign	0.00
IGL01991:Asxl3	APN	18	22516162	missense	probably damaging	1.00
IGL02064:Asxl3	APN	18	22524344	missense	possibly damaging	0.59
IGL02187:Asxl3	APN	18	22524978	missense	probably damaging	0.99
IGL02219:Asxl3	APN	18	22453626	missense	possibly damaging	0.81
IGL02309:Asxl3	APN	18	22522453	missense	probably benign	0.01
IGL02478:Asxl3	APN	18	22523013	missense	possibly damaging	0.77
IGL02506:Asxl3	APN	18	22452399	missense	probably benign	0.19
IGL02660:Asxl3	APN	18	22524345	missense	probably damaging	0.98
IGL02828:Asxl3	APN	18	22524661	missense	possibly damaging	0.87
IGL02863:Asxl3	APN	18	22523484	missense	probably benign	0.01
IGL03001:Asxl3	APN	18	22517398	missense	probably damaging	1.00
IGL03143:Asxl3	APN	18	22522974	missense	probably benign	0.43
ANU22:Asxl3	UTSW	18	22516446	missense	probably benign	0.06
BB001:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
BB011:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R0145:Asxl3	UTSW	18	22453605	missense	probably damaging	1.00
R0201:Asxl3	UTSW	18	22523154	missense	probably benign
R0207:Asxl3	UTSW	18	22411496	splice site	probably benign
R0230:Asxl3	UTSW	18	22452326	splice site	probably benign
R0242:Asxl3	UTSW	18	22516681	missense	possibly damaging	0.94
R0344:Asxl3	UTSW	18	22517611	missense	probably benign	0.00
R0519:Asxl3	UTSW	18	22523520	missense	possibly damaging	0.85
R0520:Asxl3	UTSW	18	22522986	missense	probably damaging	0.96
R0548:Asxl3	UTSW	18	22521792	splice site	probably benign
R0626:Asxl3	UTSW	18	22522880	missense	probably benign	0.02
R0711:Asxl3	UTSW	18	22524451	missense	probably benign	0.01
R0744:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R0833:Asxl3	UTSW	18	22516040	missense	probably damaging	1.00
R1035:Asxl3	UTSW	18	22525049	missense	probably damaging	1.00
R1170:Asxl3	UTSW	18	22524507	missense	probably benign	0.00
R1372:Asxl3	UTSW	18	22410009	missense	probably benign	0.00
R1440:Asxl3	UTSW	18	22525224	missense	probably benign	0.13
R1463:Asxl3	UTSW	18	22516753	missense	possibly damaging	0.94
R1471:Asxl3	UTSW	18	22516354	missense	probably damaging	1.00
R1618:Asxl3	UTSW	18	22516987	missense	probably damaging	1.00
R1720:Asxl3	UTSW	18	22452435	missense	probably damaging	1.00
R1819:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R1824:Asxl3	UTSW	18	22522068	missense	probably damaging	1.00
R1851:Asxl3	UTSW	18	22517739	missense	probably damaging	0.97
R1989:Asxl3	UTSW	18	22452363	missense	probably damaging	1.00
R2041:Asxl3	UTSW	18	22523451	missense	probably benign	0.02
R2174:Asxl3	UTSW	18	22453644	missense	possibly damaging	0.76
R2175:Asxl3	UTSW	18	22516595	missense	probably benign
R2443:Asxl3	UTSW	18	22411539	missense	probably benign	0.12
R2907:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R4246:Asxl3	UTSW	18	22525500	missense	probably damaging	1.00
R4254:Asxl3	UTSW	18	22524366	missense	possibly damaging	0.58
R4441:Asxl3	UTSW	18	22524233	missense	probably damaging	0.97
R4660:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4661:Asxl3	UTSW	18	22516477	missense	probably benign	0.00
R4674:Asxl3	UTSW	18	22517738	missense	probably damaging	1.00
R4749:Asxl3	UTSW	18	22516769	missense	probably damaging	0.99
R4817:Asxl3	UTSW	18	22525454	missense	probably damaging	0.97
R4935:Asxl3	UTSW	18	22523312	missense	probably benign	0.06
R5062:Asxl3	UTSW	18	22522718	missense	possibly damaging	0.92
R5064:Asxl3	UTSW	18	22516019	missense	probably benign	0.00
R5065:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5066:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5067:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5133:Asxl3	UTSW	18	22516708	missense	probably damaging	1.00
R5174:Asxl3	UTSW	18	22523115	missense	probably benign	0.45
R5183:Asxl3	UTSW	18	22525299	missense	possibly damaging	0.94
R5294:Asxl3	UTSW	18	22516439	missense	possibly damaging	0.77
R5416:Asxl3	UTSW	18	22524494	missense	probably damaging	1.00
R5587:Asxl3	UTSW	18	22525247	missense	probably benign	0.28
R5873:Asxl3	UTSW	18	22516085	missense	probably benign	0.04
R6240:Asxl3	UTSW	18	22465508	missense	probably damaging	1.00
R6242:Asxl3	UTSW	18	22522376	missense	probably damaging	1.00
R6316:Asxl3	UTSW	18	22522782	missense	probably damaging	1.00
R6348:Asxl3	UTSW	18	22517273	missense	possibly damaging	0.56
R6518:Asxl3	UTSW	18	22516340	missense	probably damaging	0.96
R6605:Asxl3	UTSW	18	22517077	nonsense	probably null
R6704:Asxl3	UTSW	18	22517305	missense	probably benign	0.00
R6706:Asxl3	UTSW	18	22453609	missense	probably damaging	1.00
R6786:Asxl3	UTSW	18	22525440	missense	probably damaging	1.00
R6799:Asxl3	UTSW	18	22465400	nonsense	probably null
R6811:Asxl3	UTSW	18	22522911	missense	possibly damaging	0.87
R6817:Asxl3	UTSW	18	22523580	missense	probably benign	0.00
R6830:Asxl3	UTSW	18	22525388	missense	probably benign	0.45
R6957:Asxl3	UTSW	18	22522091	missense	probably damaging	1.00
R7015:Asxl3	UTSW	18	22523921	missense	probably benign	0.00
R7058:Asxl3	UTSW	18	22517674	missense	probably damaging	1.00
R7135:Asxl3	UTSW	18	22517701	nonsense	probably null
R7135:Asxl3	UTSW	18	22517702	missense	probably damaging	1.00
R7231:Asxl3	UTSW	18	22411499	critical splice acceptor site	probably null
R7231:Asxl3	UTSW	18	22517540	missense	probably damaging	1.00
R7431:Asxl3	UTSW	18	22516953	missense	probably damaging	1.00
R7851:Asxl3	UTSW	18	22517222	missense	possibly damaging	0.62
R7871:Asxl3	UTSW	18	22524224	missense	not run
R7880:Asxl3	UTSW	18	22522151	missense	possibly damaging	0.90
R7924:Asxl3	UTSW	18	22525545	missense	probably damaging	0.98
R8061:Asxl3	UTSW	18	22524243	missense	possibly damaging	0.62
R8115:Asxl3	UTSW	18	22517585	missense	probably damaging	0.99
R8174:Asxl3	UTSW	18	22517743	missense	probably benign	0.02
R8303:Asxl3	UTSW	18	22524416	missense	probably benign
R8360:Asxl3	UTSW	18	22516117	missense	probably benign
R8547:Asxl3	UTSW	18	22522772	missense	probably benign	0.04
R8699:Asxl3	UTSW	18	22434607	missense	probably benign	0.02
R8774:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8774-TAIL:Asxl3	UTSW	18	22524044	missense	probably damaging	0.99
R8867:Asxl3	UTSW	18	22516490	missense	possibly damaging	0.87
R8915:Asxl3	UTSW	18	22524706	missense	probably benign	0.00
R8954:Asxl3	UTSW	18	22517750	missense	probably damaging	1.00
R9031:Asxl3	UTSW	18	22524344	missense	probably damaging	0.96
R9047:Asxl3	UTSW	18	22452408	missense	probably damaging	1.00
R9047:Asxl3	UTSW	18	22452414	missense	probably damaging	1.00
R9135:Asxl3	UTSW	18	22516613	missense	probably damaging	0.99
R9135:Asxl3	UTSW	18	22524424	missense	possibly damaging	0.89
R9210:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9212:Asxl3	UTSW	18	22522332	missense	probably benign	0.15
R9285:Asxl3	UTSW	18	22521932	missense	probably damaging	1.00
R9572:Asxl3	UTSW	18	22516055	missense	probably benign	0.25
R9707:Asxl3	UTSW	18	22523247	missense	probably benign	0.01
R9768:Asxl3	UTSW	18	22517044	missense	probably benign	0.00
R9784:Asxl3	UTSW	18	22517254	missense	probably benign
Z1088:Asxl3	UTSW	18	22516772	missense	probably benign	0.00
Z1176:Asxl3	UTSW	18	22522220	missense	probably damaging	1.00
Z1177:Asxl3	UTSW	18	22516339	missense	probably benign	0.00
Z1177:Asxl3	UTSW	18	22523591	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGCCATCTTCTCTAGAAAGCCAAC -3'
(R):5'- TGGATACTGGTGATGCCTCAGACG -3'

Sequencing Primer
(F):5'- CAACTTCCAAATGAGGGGATTGC -3'
(R):5'- CAAGTTGGACATAAGAGATGCTTCTG -3'

Posted On

2013-07-11