Incidental Mutation 'R7375:Slc22a26'
ID596141
Institutional Source Beutler Lab
Gene Symbol Slc22a26
Ensembl Gene ENSMUSG00000053303
Gene Namesolute carrier family 22 (organic cation transporter), member 26
SynonymsBC014805
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7375 (G1)
Quality Score218.009
Status Validated
Chromosome19
Chromosomal Location7781041-7802667 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 7783144 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065634] [ENSMUST00000120522]
Predicted Effect probably null
Transcript: ENSMUST00000065634
SMART Domains Protein: ENSMUSP00000064809
Gene: ENSMUSG00000053303

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 96 528 1.1e-23 PFAM
Pfam:MFS_1 124 370 7.8e-17 PFAM
Pfam:MFS_1 350 547 2.1e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120522
SMART Domains Protein: ENSMUSP00000113607
Gene: ENSMUSG00000053303

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Pfam:Sugar_tr 94 527 4.9e-23 PFAM
Pfam:MFS_1 124 358 1.2e-15 PFAM
Pfam:MFS_1 349 547 2.4e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Slc22a26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc22a26 APN 19 7782836 missense probably damaging 0.99
IGL00338:Slc22a26 APN 19 7782975 missense probably benign 0.25
IGL00736:Slc22a26 APN 19 7790162 missense possibly damaging 0.50
IGL01085:Slc22a26 APN 19 7790099 missense probably benign 0.02
IGL01581:Slc22a26 APN 19 7802184 missense probably benign 0.15
IGL02502:Slc22a26 APN 19 7790760 critical splice donor site probably null
IGL02658:Slc22a26 APN 19 7788248 missense probably benign 0.25
IGL02936:Slc22a26 APN 19 7791105 missense probably damaging 0.99
IGL03162:Slc22a26 APN 19 7802101 missense probably benign 0.00
R0034:Slc22a26 UTSW 19 7802253 missense probably benign 0.03
R0633:Slc22a26 UTSW 19 7788210 critical splice donor site probably null
R0676:Slc22a26 UTSW 19 7796144 splice site probably benign
R2156:Slc22a26 UTSW 19 7802115 missense probably damaging 1.00
R4043:Slc22a26 UTSW 19 7788329 critical splice acceptor site probably null
R4781:Slc22a26 UTSW 19 7790135 missense probably benign 0.34
R4896:Slc22a26 UTSW 19 7791054 missense probably benign 0.14
R4999:Slc22a26 UTSW 19 7802181 missense probably damaging 1.00
R5125:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R5178:Slc22a26 UTSW 19 7790175 missense possibly damaging 0.62
R6161:Slc22a26 UTSW 19 7786447 missense possibly damaging 0.50
R6494:Slc22a26 UTSW 19 7802286 missense probably damaging 1.00
R6512:Slc22a26 UTSW 19 7802500 start gained probably benign
R6724:Slc22a26 UTSW 19 7802361 missense probably benign 0.14
R7323:Slc22a26 UTSW 19 7790894 missense probably damaging 0.97
R7558:Slc22a26 UTSW 19 7785286 missense possibly damaging 0.94
R7634:Slc22a26 UTSW 19 7802587 utr 5 prime probably null
Predicted Primers PCR Primer
(F):5'- CAGAGTACAGCGTGAGGATC -3'
(R):5'- TTAGATTCATACCCAGGAATAGCAG -3'

Sequencing Primer
(F):5'- CAATGACTCCTAATGCTGTTGC -3'
(R):5'- CATACCCAGGAATAGCAGGGTCTTG -3'
Posted On2019-11-21