Incidental Mutation 'R7365:Cep89'
ID596157
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R7365 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35429928 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 630 (R630H)
Ref Sequence ENSEMBL: ENSMUSP00000121393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141704
AA Change: R630H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: R630H

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150421
SMART Domains Protein: ENSMUSP00000121422
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
coiled coil region 77 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (96/96)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik T C 5: 138,562,936 S155G probably benign Het
Abcc4 T C 14: 118,627,654 N320S probably damaging Het
Akr1c19 G A 13: 4,237,070 R96H probably benign Het
Ankrd17 T C 5: 90,291,151 D451G possibly damaging Het
Ano8 T A 8: 71,485,110 D36V probably damaging Het
Aqp3 A G 4: 41,098,003 V36A probably benign Het
Atf7ip A G 6: 136,560,710 T314A probably benign Het
Atp2c1 A T 9: 105,422,999 D700E probably damaging Het
Axin2 G A 11: 108,939,376 V341M possibly damaging Het
Bin3 A G 14: 70,134,527 Q139R probably damaging Het
Brca2 A G 5: 150,532,337 D181G probably damaging Het
C330027C09Rik T A 16: 49,001,653 S215T probably benign Het
Capn3 A G 2: 120,494,814 E466G probably damaging Het
Ccdc14 T A 16: 34,723,619 Y830* probably null Het
Cdk12 T C 11: 98,221,084 F723L unknown Het
Clca2 T A 3: 145,098,784 I61F probably damaging Het
Clca4b T C 3: 144,922,768 T393A not run Het
Cldn5 G A 16: 18,777,095 A34T probably damaging Het
Cobll1 A T 2: 65,098,373 S870T probably damaging Het
Col12a1 T C 9: 79,706,360 K68E probably damaging Het
Crnn A T 3: 93,148,534 Q209L probably damaging Het
Cwf19l1 A T 19: 44,132,140 F45I probably damaging Het
Cyfip2 T A 11: 46,207,440 K1052* probably null Het
D930020B18Rik G A 10: 121,667,811 probably null Het
Dcc G A 18: 71,826,123 P193S probably damaging Het
Dda1 T A 8: 71,474,493 C48S probably benign Het
Disc1 A G 8: 125,155,041 R572G probably damaging Het
Dnah7a A T 1: 53,497,138 M2582K probably benign Het
Dsel C T 1: 111,861,573 G411S probably damaging Het
Dynlrb2 T C 8: 116,514,957 V80A probably benign Het
Eif3a A T 19: 60,766,644 D1033E unknown Het
Enam C A 5: 88,501,488 H285Q possibly damaging Het
Ep400 T C 5: 110,719,614 D980G unknown Het
Epha7 C T 4: 28,871,937 S422L probably benign Het
Erc2 A C 14: 28,040,389 D703A probably damaging Het
Ezh2 G T 6: 47,533,758 S639* probably null Het
Fbn1 G A 2: 125,352,049 H1333Y probably damaging Het
Flad1 A G 3: 89,408,665 S197P possibly damaging Het
Gfm2 G T 13: 97,143,021 C26F probably benign Het
Gm5294 A G 5: 138,820,981 H82R probably damaging Het
Gm597 A T 1: 28,780,152 M16K probably benign Het
Golga2 C T 2: 32,303,001 Q444* probably null Het
Gp5 A T 16: 30,308,608 V416D probably damaging Het
Gpat2 A G 2: 127,426,981 probably null Het
Gpr137c A G 14: 45,279,014 D353G probably damaging Het
Hoxa13 A C 6: 52,259,882 W133G probably damaging Het
Hydin A T 8: 110,557,662 I3189F probably damaging Het
Hydin A T 8: 110,601,273 K4804M probably damaging Het
Ice2 T C 9: 69,400,512 F26S probably damaging Het
Ints11 T C 4: 155,872,230 probably null Het
Ipo5 A G 14: 120,920,085 I112V probably benign Het
Itgax T A 7: 128,135,309 S346R probably damaging Het
Kcnj13 T A 1: 87,389,017 M125L probably damaging Het
Lmbrd1 T A 1: 24,744,867 V359E possibly damaging Het
Lrrc7 T G 3: 158,198,161 K287N probably damaging Het
Mau2 C T 8: 70,029,234 A191T possibly damaging Het
Mkx C A 18: 7,000,747 R65L possibly damaging Het
Mroh4 T A 15: 74,610,371 K746* probably null Het
Myh4 A G 11: 67,242,848 T238A probably damaging Het
Nlrp9c T A 7: 26,371,397 N920Y possibly damaging Het
Nr4a3 T G 4: 48,051,290 S15A possibly damaging Het
Ntn4 T C 10: 93,644,804 L130P probably damaging Het
Olfr1240 A G 2: 89,440,198 V27A probably benign Het
Olfr1312 A T 2: 112,043,014 V6E possibly damaging Het
Olfr682-ps1 T A 7: 105,128,345 I21F probably benign Het
Olfr695 A G 7: 106,713,964 V239A probably benign Het
Olfr930 A T 9: 38,930,776 I202F probably damaging Het
Otog T C 7: 46,298,308 L110P probably damaging Het
Platr25 G A 13: 62,700,905 H48Y probably benign Het
Plcxd2 T C 16: 45,980,426 E145G probably damaging Het
Pltp A T 2: 164,854,322 N143K probably damaging Het
Pnpt1 T C 11: 29,161,334 Y735H probably damaging Het
Prom1 A G 5: 44,020,831 Y520H probably damaging Het
Rag2 A G 2: 101,630,773 Y476C probably damaging Het
Rdh16f2 A G 10: 127,877,024 Y297C probably damaging Het
Ryr1 T C 7: 29,085,755 E1844G probably benign Het
Ryr2 A G 13: 11,640,275 C3679R probably damaging Het
Sirt1 A G 10: 63,322,003 I544T probably benign Het
Slc26a10 A T 10: 127,176,847 I382N possibly damaging Het
Sox2 C A 3: 34,650,972 P186Q possibly damaging Het
Tnpo3 A G 6: 29,556,996 L752P probably damaging Het
Top2b T A 14: 16,416,649 N1136K probably benign Het
Tpsg1 G T 17: 25,373,210 G86V probably damaging Het
Ttf2 C A 3: 100,963,302 D152Y possibly damaging Het
Txndc15 T C 13: 55,714,788 L4P unknown Het
Unc5a T C 13: 54,996,573 V237A possibly damaging Het
Urb1 CACTTAC CAC 16: 90,772,573 probably benign Het
Vav3 C A 3: 109,628,099 P616T possibly damaging Het
Vmn2r15 T A 5: 109,293,239 D251V probably benign Het
Vmn2r15 A G 5: 109,297,522 L12S probably benign Het
Wfs1 A C 5: 36,967,732 I605S probably benign Het
Wif1 G A 10: 121,083,909 R187Q possibly damaging Het
Yipf1 A G 4: 107,350,541 probably null Het
Zdhhc20 G T 14: 57,873,920 F74L possibly damaging Het
Zfp507 T C 7: 35,776,418 T303A unknown Het
Zfp763 A T 17: 33,033,378 probably benign Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4414:Cep89 UTSW 7 35416397 unclassified probably benign
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6361:Cep89 UTSW 7 35398047 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
R7340:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7341:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7347:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7348:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7366:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7394:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7399:Cep89 UTSW 7 35438378 missense probably damaging 1.00
R7422:Cep89 UTSW 7 35428247 missense probably damaging 1.00
R7819:Cep89 UTSW 7 35432543 missense probably benign 0.07
R7860:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
R7943:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGACAATCACAGGCCATGC -3'
(R):5'- GAAGGCTTGTAAGAAACATCACCTG -3'

Sequencing Primer
(F):5'- AATCACAGGCCATGCTGGGG -3'
(R):5'- CTTGTAAGAAACATCACCTGGAAGTC -3'
Posted On2019-11-22