Incidental Mutation 'R7460:Ddx1'
ID596163
Institutional Source Beutler Lab
Gene Symbol Ddx1
Ensembl Gene ENSMUSG00000037149
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7460 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location13216973-13249213 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 13231439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000065987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071103]
Predicted Effect probably null
Transcript: ENSMUST00000071103
SMART Domains Protein: ENSMUSP00000065987
Gene: ENSMUSG00000037149

DomainStartEndE-ValueType
DEXDc 21 444 1.95e-47 SMART
SPRY 130 246 1.91e-34 SMART
HELICc 520 610 8.28e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein of unknown function. It shows high transcription levels in 2 retinoblastoma cell lines and in tissues of neuroectodermal origin. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1300017J02Rik T C 9: 103,254,648 N625D probably benign Het
Abi2 T A 1: 60,434,307 V61D probably damaging Het
Agrn C A 4: 156,174,424 V915L probably damaging Het
Arhgap24 T C 5: 102,892,346 V476A probably benign Het
Arhgef15 A G 11: 68,947,035 L720P probably damaging Het
Atad2b C A 12: 4,952,660 R343S probably benign Het
Atxn3 T A 12: 101,926,517 T313S probably benign Het
BC037034 G A 5: 138,262,729 T218M probably benign Het
BC051665 T C 13: 60,784,643 E76G probably benign Het
Birc2 A T 9: 7,818,761 F610I probably damaging Het
Cdh16 A T 8: 104,622,291 V58D possibly damaging Het
Cenpf T C 1: 189,654,050 D2011G probably damaging Het
Ddb1 T C 19: 10,607,911 probably null Het
Disp2 A G 2: 118,789,780 H331R probably damaging Het
Dmxl1 A G 18: 49,878,612 T1279A probably benign Het
Dync1i2 T C 2: 71,250,886 I473T probably damaging Het
Fam114a1 T G 5: 65,038,707 V520G possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 T A 11: 55,278,963 D2990V probably damaging Het
Fbxo18 C T 2: 11,756,685 G597D probably benign Het
Fdxr A C 11: 115,276,854 S12A probably benign Het
Fgf14 T A 14: 124,676,693 R9W possibly damaging Het
Gnat3 A T 5: 17,999,658 D103V Het
Hepacam2 G A 6: 3,487,199 P53S probably benign Het
Jmjd1c A G 10: 67,217,036 T21A probably benign Het
Lama1 T C 17: 67,767,018 C930R Het
Lrp1b T C 2: 40,598,466 T4536A Het
Lrrc27 T A 7: 139,223,658 V166E probably damaging Het
Mapk10 C T 5: 103,038,577 V90I probably benign Het
Mfsd14b C T 13: 65,072,023 G339D probably damaging Het
Mkl2 G T 16: 13,400,976 Q495H probably benign Het
Mnt T A 11: 74,843,283 M580K unknown Het
Mrc1 T C 2: 14,248,869 S234P probably damaging Het
Mrps5 G A 2: 127,591,891 V75I not run Het
Myo10 A G 15: 25,807,827 D1845G probably damaging Het
Olfr147 T C 9: 38,403,353 S160P possibly damaging Het
Olfr19 C A 16: 16,673,166 A272S possibly damaging Het
Olfr402 A T 11: 74,155,846 I231F probably damaging Het
Olfr559 A T 7: 102,723,821 M223K probably benign Het
Pdhx G A 2: 103,046,779 T95M probably damaging Het
Pigb C T 9: 73,038,675 V72I probably damaging Het
Prr7 C A 13: 55,472,353 P110Q unknown Het
Psg22 A G 7: 18,724,404 D340G probably benign Het
Ptprn2 T C 12: 117,248,681 S908P probably benign Het
Ros1 T C 10: 52,118,203 Y1348C probably damaging Het
Rspry1 T C 8: 94,650,335 I506T probably benign Het
Ryr2 T A 13: 11,705,710 Y2684F probably benign Het
Sdr16c6 A G 4: 4,076,575 probably null Het
Senp7 A G 16: 56,173,182 T743A possibly damaging Het
Slc6a20b T C 9: 123,604,949 I275V probably benign Het
Slc6a7 A G 18: 61,001,602 I467T probably benign Het
Tacc2 A G 7: 130,624,633 D1016G probably benign Het
Thsd7a A G 6: 12,554,934 V317A Het
Tle3 A G 9: 61,413,084 H598R probably damaging Het
Tmem102 A G 11: 69,804,123 L341P probably damaging Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Trhde T A 10: 114,413,263 D866V probably damaging Het
Ttn A G 2: 76,751,273 I23092T probably damaging Het
U2surp C A 9: 95,462,824 V944L unknown Het
Urgcp T C 11: 5,716,622 H615R possibly damaging Het
Vps45 T A 3: 96,048,387 Y97F probably benign Het
Zc3h12c T C 9: 52,144,102 T136A probably benign Het
Zfp948 A T 17: 21,588,415 H623L probably damaging Het
Other mutations in Ddx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ddx1 APN 12 13227459 splice site probably benign
IGL00725:Ddx1 APN 12 13245690 missense probably damaging 1.00
IGL00958:Ddx1 APN 12 13240848 splice site probably null
IGL01786:Ddx1 APN 12 13229136 missense probably benign
IGL02832:Ddx1 APN 12 13227317 nonsense probably null
IGL02983:Ddx1 APN 12 13223862 missense probably damaging 1.00
R0201:Ddx1 UTSW 12 13223808 missense probably damaging 1.00
R0931:Ddx1 UTSW 12 13237817 splice site probably benign
R1434:Ddx1 UTSW 12 13237231 missense probably benign 0.01
R1558:Ddx1 UTSW 12 13239541 missense probably damaging 1.00
R1673:Ddx1 UTSW 12 13244966 critical splice donor site probably null
R1854:Ddx1 UTSW 12 13229331 missense probably benign 0.19
R2910:Ddx1 UTSW 12 13231440 splice site probably null
R2911:Ddx1 UTSW 12 13231440 splice site probably null
R4181:Ddx1 UTSW 12 13231503 nonsense probably null
R4182:Ddx1 UTSW 12 13231503 nonsense probably null
R4183:Ddx1 UTSW 12 13231503 nonsense probably null
R4231:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4234:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4235:Ddx1 UTSW 12 13223857 missense possibly damaging 0.74
R4243:Ddx1 UTSW 12 13240909 nonsense probably null
R4717:Ddx1 UTSW 12 13240887 missense probably damaging 1.00
R4821:Ddx1 UTSW 12 13239147 missense probably damaging 1.00
R5032:Ddx1 UTSW 12 13223992 missense probably damaging 1.00
R5082:Ddx1 UTSW 12 13220435 nonsense probably null
R5528:Ddx1 UTSW 12 13229294 missense probably damaging 1.00
R5997:Ddx1 UTSW 12 13237799 missense probably damaging 1.00
R6398:Ddx1 UTSW 12 13245720 missense probably damaging 1.00
R6891:Ddx1 UTSW 12 13236095 missense probably benign 0.25
R7085:Ddx1 UTSW 12 13229355 missense probably damaging 1.00
R7125:Ddx1 UTSW 12 13243863 missense probably benign 0.18
R7307:Ddx1 UTSW 12 13223959 missense probably damaging 1.00
R7388:Ddx1 UTSW 12 13225455 missense probably null 1.00
R7393:Ddx1 UTSW 12 13230353 missense probably benign 0.03
X0011:Ddx1 UTSW 12 13229415 missense probably damaging 1.00
X0028:Ddx1 UTSW 12 13243866 missense probably benign 0.00
Z1177:Ddx1 UTSW 12 13229259 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGTAATCCCGTGTCAGGACC -3'
(R):5'- TGAAGTAGAAAGTGGCATTTTGCTG -3'

Sequencing Primer
(F):5'- ATCAGATGCTCAAGTCCTTGG -3'
(R):5'- GAAAGTGGCATTTTGCTGTTTTAAAG -3'
Posted On2019-11-22