Mutagenetix > Incidental Mutations

Incidental Mutation 'R7735:Aox1'

596170

Institutional Source

Beutler Lab

Gene Symbol

Aox1

Ensembl Gene

ENSMUSG00000063558

Gene Name

aldehyde oxidase 1

Synonyms

Aox-1, Aox2, retinal oxidase, Aox-2

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58029931-58106413 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 58068292 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 575 (P575L)

Ref Sequence

ENSEMBL: ENSMUSP00000001027 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001027]

Predicted Effect

probably benign
Transcript: ENSMUST00000001027
AA Change: P575L

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000001027
Gene: ENSMUSG00000063558
AA Change: P575L

Domain	Start	End	E-Value	Type
Pfam:Fer2	8	78	8.5e-11	PFAM
Pfam:Fer2_2	87	161	2.4e-32	PFAM
low complexity region	197	209	N/A	INTRINSIC
Pfam:FAD_binding_5	238	418	1.2e-46	PFAM
CO_deh_flav_C	425	529	8.06e-24	SMART
Ald_Xan_dh_C	593	696	6.99e-42	SMART
Pfam:Ald_Xan_dh_C2	707	1240	2.1e-176	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,783,780	T617A	probably benign	Het
Agl	A	T	3: 116,785,146	I446N	probably benign	Het
Ap2m1	A	T	16: 20,539,519	I96F	probably benign	Het
Arhgap15	A	G	2: 44,116,630	D253G	probably damaging	Het
Arsa	A	T	15: 89,474,949	C171*	probably null	Het
Arsb	G	T	13: 93,771,983	R69L	probably benign	Het
Asb13	G	A	13: 3,634,180		probably null	Het
Canx	G	T	11: 50,301,039	D348E	probably damaging	Het
Cebpz	C	T	17: 78,925,913		probably null	Het
Ces2h	A	T	8: 105,014,495	I40L	probably benign	Het
Csmd2	T	C	4: 128,456,930		probably null	Het
Cxadr	T	A	16: 78,329,061	N106K	possibly damaging	Het
Ddo	T	C	10: 40,631,774	C56R	probably benign	Het
Dnah6	C	T	6: 73,069,429	G3192D	probably damaging	Het
Efcab3	T	A	11: 105,071,639	V49E	probably benign	Het
Epha10	T	C	4: 124,913,679	Y578H		Het
Fbxw16	T	C	9: 109,441,067	D202G	probably damaging	Het
Gm4788	A	G	1: 139,732,301		probably null	Het
Gzf1	T	C	2: 148,688,163	V538A	possibly damaging	Het
Igha	T	A	12: 113,256,399		probably benign	Het
Iqce	G	T	5: 140,678,084	Q457K	probably benign	Het
Kbtbd3	A	G	9: 4,330,846	K407E	possibly damaging	Het
Lipt1	A	G	1: 37,875,622	E253G	probably damaging	Het
Mrnip	G	A	11: 50,196,973	W107*	probably null	Het
Mroh4	T	C	15: 74,625,508	T224A	probably damaging	Het
Ncoa2	A	T	1: 13,148,437	S1389R	probably benign	Het
Npffr2	A	G	5: 89,583,314	I368V	probably benign	Het
Nrd1	C	T	4: 109,037,985	L469F	probably damaging	Het
Nup210l	A	T	3: 90,185,576	Q1279L	probably damaging	Het
Olfr1297	T	A	2: 111,621,474	N200I	probably damaging	Het
Olfr862	A	G	9: 19,884,114	Y64H	probably damaging	Het
Pcdha4	T	G	18: 36,952,908	I48S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,089	Y211C	possibly damaging	Het
Ppil2	G	T	16: 17,100,260	S97R	probably benign	Het
Prrt4	A	T	6: 29,170,036	S806T	possibly damaging	Het
Ptpn20	T	A	14: 33,630,945	Y214N	probably damaging	Het
Ptprt	A	T	2: 161,575,741	N938K	probably damaging	Het
Scn2a	G	T	2: 65,763,669	V1621L	probably benign	Het
Senp3	A	G	11: 69,678,261	I358T	probably damaging	Het
Sf3b1	A	T	1: 55,003,349	S461T	probably benign	Het
Slc22a2	C	T	17: 12,610,030	T341I	probably damaging	Het
Slc38a7	A	T	8: 95,841,667	D363E	probably benign	Het
Slc6a5	T	C	7: 49,948,342		probably null	Het
Smo	T	A	6: 29,759,852	V650E	probably damaging	Het
Spata17	G	A	1: 187,140,380	T31I	unknown	Het
Sstr2	T	A	11: 113,624,597	I114N	possibly damaging	Het
Styxl1	T	C	5: 135,759,169	Y146C	probably damaging	Het
Synpo2l	T	C	14: 20,661,175	Q688R	possibly damaging	Het
Tmem245	C	T	4: 56,925,155	R322H	probably benign	Het
Tnxb	A	G	17: 34,671,424	E247G	unknown	Het
Ttc28	A	T	5: 111,266,678		probably null	Het
Ttn	C	A	2: 76,822,424		probably null	Het
Ttn	A	T	2: 76,888,072	I7255N	unknown	Het
Unc13b	C	T	4: 43,165,791	R204C	probably damaging	Het
Utrn	A	G	10: 12,744,043		probably null	Het
Vps53	A	T	11: 76,047,136	F753I	probably damaging	Het
Zdbf2	A	G	1: 63,304,105	T548A	possibly damaging	Het
Zfp747	G	A	7: 127,374,500	T166M	probably damaging	Het

Other mutations in Aox1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Aox1	APN	1	58059044	missense	probably damaging	1.00
IGL01077:Aox1	APN	1	58057410	splice site	probably benign
IGL01335:Aox1	APN	1	58082153	nonsense	probably null
IGL01410:Aox1	APN	1	58106025	splice site	probably null
IGL01684:Aox1	APN	1	58077581	splice site	probably null
IGL01727:Aox1	APN	1	58073228	nonsense	probably null
IGL01805:Aox1	APN	1	58081513	missense	possibly damaging	0.94
IGL01996:Aox1	APN	1	58082066	missense	probably benign	0.11
IGL02060:Aox1	APN	1	58097955	missense	possibly damaging	0.95
IGL02206:Aox1	APN	1	58065340	missense	probably benign	0.00
IGL02839:Aox1	APN	1	58068784	missense	probably benign	0.05
IGL02975:Aox1	APN	1	58068391	missense	probably damaging	1.00
IGL03062:Aox1	APN	1	58078465	missense	probably benign	0.01
IGL03286:Aox1	APN	1	58049384	missense	probably benign	0.19
IGL03335:Aox1	APN	1	58076160	missense	probably damaging	0.98
IGL03395:Aox1	APN	1	58068725	splice site	probably benign
R0048:Aox1	UTSW	1	58073212	missense	probably damaging	0.98
R0144:Aox1	UTSW	1	58070074	missense	probably benign	0.00
R0207:Aox1	UTSW	1	58105014	missense	possibly damaging	0.82
R0357:Aox1	UTSW	1	58092516	missense	probably damaging	1.00
R0383:Aox1	UTSW	1	58061241	missense	probably benign	0.00
R0399:Aox1	UTSW	1	58068849	splice site	probably null
R0465:Aox1	UTSW	1	58062207	missense	probably damaging	1.00
R0480:Aox1	UTSW	1	58043651	splice site	probably benign
R1005:Aox1	UTSW	1	58065352	missense	probably benign	0.00
R1507:Aox1	UTSW	1	58104451	missense	probably benign	0.01
R1597:Aox1	UTSW	1	58047167	missense	probably damaging	1.00
R1693:Aox1	UTSW	1	58085542	missense	probably damaging	1.00
R1709:Aox1	UTSW	1	58077474	missense	probably benign
R1869:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1870:Aox1	UTSW	1	58076103	missense	probably damaging	1.00
R1898:Aox1	UTSW	1	58078442	missense	probably damaging	1.00
R1908:Aox1	UTSW	1	58102624	missense	probably damaging	1.00
R2002:Aox1	UTSW	1	58047141	missense	possibly damaging	0.69
R2062:Aox1	UTSW	1	58059192	splice site	probably null
R2065:Aox1	UTSW	1	58059192	splice site	probably null
R2265:Aox1	UTSW	1	58081520	missense	probably damaging	0.99
R3713:Aox1	UTSW	1	58056215	missense	probably benign	0.01
R3778:Aox1	UTSW	1	58053703	missense	possibly damaging	0.89
R4198:Aox1	UTSW	1	58085607	missense	probably benign
R4296:Aox1	UTSW	1	58057400	splice site	probably null
R4562:Aox1	UTSW	1	58059056	missense	probably damaging	0.99
R4858:Aox1	UTSW	1	58104481	missense	probably benign
R4862:Aox1	UTSW	1	58095157	missense	probably damaging	0.98
R5048:Aox1	UTSW	1	58059482	splice site	probably benign
R5127:Aox1	UTSW	1	58030026	missense	probably benign	0.00
R5139:Aox1	UTSW	1	58061297	missense	probably benign	0.03
R5157:Aox1	UTSW	1	58070063	missense	probably damaging	1.00
R5168:Aox1	UTSW	1	58049402	missense	probably damaging	1.00
R5186:Aox1	UTSW	1	58068370	missense	probably damaging	1.00
R5235:Aox1	UTSW	1	58057555	missense	possibly damaging	0.77
R5289:Aox1	UTSW	1	58092558	missense	probably damaging	0.99
R5466:Aox1	UTSW	1	58041460	missense	probably damaging	1.00
R5540:Aox1	UTSW	1	58104410	missense	probably benign	0.03
R5615:Aox1	UTSW	1	58096966	missense	probably benign
R5652:Aox1	UTSW	1	58095197	missense	probably damaging	1.00
R5920:Aox1	UTSW	1	58049472	missense	probably damaging	1.00
R6008:Aox1	UTSW	1	58077513	missense	probably damaging	1.00
R6073:Aox1	UTSW	1	58104509	critical splice donor site	probably null
R6215:Aox1	UTSW	1	58085461	missense	probably benign
R6403:Aox1	UTSW	1	58068435	missense	probably damaging	1.00
R6440:Aox1	UTSW	1	58094472	missense	probably damaging	1.00
R6601:Aox1	UTSW	1	58063506	missense	probably damaging	1.00
R6608:Aox1	UTSW	1	58057546	missense	probably benign	0.40
R6752:Aox1	UTSW	1	58047239	missense	probably benign	0.00
R6989:Aox1	UTSW	1	58085452	missense	probably damaging	1.00
R7042:Aox1	UTSW	1	58102600	missense	probably damaging	0.99
R7442:Aox1	UTSW	1	58082013	missense	probably damaging	1.00
R7506:Aox1	UTSW	1	58049403	missense	probably damaging	1.00
R7563:Aox1	UTSW	1	58047145	missense	probably benign	0.32
R7589:Aox1	UTSW	1	58041484	missense	probably damaging	1.00
R7814:Aox1	UTSW	1	58085467	missense	probably benign
R7876:Aox1	UTSW	1	58062171	nonsense	probably null
R7905:Aox1	UTSW	1	58104398	missense	possibly damaging	0.72
R7908:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
R7959:Aox1	UTSW	1	58062171	nonsense	probably null
R7988:Aox1	UTSW	1	58104398	missense	possibly damaging	0.72
R7989:Aox1	UTSW	1	58106068	missense	possibly damaging	0.68
Z1088:Aox1	UTSW	1	58081542	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTGCCAAATTGTTCCCATAAC -3'
(R):5'- TTCATTGAGTGGGCAGAGTTAGAC -3'

Sequencing Primer
(F):5'- GTTCCCATAACCTCTTTTGAGTAGTG -3'
(R):5'- AAGAATCTTCCTATGTGTGGAGG -3'

Posted On

2019-11-26