Incidental Mutation 'R7735:Spata17'
ID596173
Institutional Source Beutler Lab
Gene Symbol Spata17
Ensembl Gene ENSMUSG00000026611
Gene Namespermatogenesis associated 17
Synonyms1700065F16Rik, 4930504I07Rik, 4930513F16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7735 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location187044648-187215465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 187140380 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 31 (T31I)
Ref Sequence ENSEMBL: ENSMUSP00000139009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027908] [ENSMUST00000110945] [ENSMUST00000183819] [ENSMUST00000183931] [ENSMUST00000183996] [ENSMUST00000184543]
Predicted Effect probably damaging
Transcript: ENSMUST00000027908
AA Change: T187I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027908
Gene: ENSMUSG00000026611
AA Change: T187I

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110945
AA Change: T187I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106570
Gene: ENSMUSG00000026611
AA Change: T187I

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183819
AA Change: T187I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138855
Gene: ENSMUSG00000026611
AA Change: T187I

DomainStartEndE-ValueType
IQ 47 69 5.27e0 SMART
IQ 70 92 1.77e-2 SMART
IQ 106 128 1.4e1 SMART
coiled coil region 133 174 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183931
AA Change: T78I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139329
Gene: ENSMUSG00000026611
AA Change: T78I

DomainStartEndE-ValueType
low complexity region 39 63 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183996
AA Change: T31I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139073
Gene: ENSMUSG00000026611
AA Change: T31I

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000184543
AA Change: T31I
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Asb13 G A 13: 3,634,180 probably null Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttc28 A T 5: 111,266,678 probably null Het
Ttn C A 2: 76,822,424 probably null Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Spata17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Spata17 APN 1 187117339 missense probably benign 0.34
IGL02101:Spata17 APN 1 187117460 missense probably benign 0.40
IGL02268:Spata17 APN 1 187140398 missense probably damaging 0.97
IGL02406:Spata17 APN 1 187117261 critical splice donor site probably null
IGL02429:Spata17 APN 1 187140434 missense possibly damaging 0.66
IGL03333:Spata17 APN 1 187140470 start codon destroyed probably null
R0147:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0148:Spata17 UTSW 1 187112601 missense probably damaging 1.00
R0269:Spata17 UTSW 1 187097872 missense probably benign 0.02
R1521:Spata17 UTSW 1 187193994 missense probably damaging 0.96
R1620:Spata17 UTSW 1 187183215 intron probably benign
R2017:Spata17 UTSW 1 187048453 missense possibly damaging 0.73
R2113:Spata17 UTSW 1 187097911 missense possibly damaging 0.93
R2251:Spata17 UTSW 1 187048473 missense possibly damaging 0.96
R4260:Spata17 UTSW 1 187048480 missense possibly damaging 0.53
R4572:Spata17 UTSW 1 187193996 missense possibly damaging 0.91
R4894:Spata17 UTSW 1 187140446 missense probably benign 0.00
R4910:Spata17 UTSW 1 187194011 missense probably damaging 0.98
R6277:Spata17 UTSW 1 187193954 nonsense probably null
R7200:Spata17 UTSW 1 187112503 missense probably benign 0.00
R7621:Spata17 UTSW 1 187122636 splice site probably null
R7990:Spata17 UTSW 1 187140395 missense unknown
R8115:Spata17 UTSW 1 187117456 missense probably damaging 1.00
V7732:Spata17 UTSW 1 187048480 missense possibly damaging 0.53
X0027:Spata17 UTSW 1 187193959 missense probably damaging 0.97
Z1177:Spata17 UTSW 1 187117328 missense possibly damaging 0.86
Z1177:Spata17 UTSW 1 187140429 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGACCTTTCTGCCAGTG -3'
(R):5'- GAATTAGCGAATCAACAGATGCC -3'

Sequencing Primer
(F):5'- TCTATGAAGCACTGTCACAGG -3'
(R):5'- TTAGCGAATCAACAGATGCCAACAG -3'
Posted On2019-11-26