Incidental Mutation 'R7735:Or4k47'
ID 596178
Institutional Source Beutler Lab
Gene Symbol Or4k47
Ensembl Gene ENSMUSG00000094858
Gene Name olfactory receptor family 4 subfamily K member 47
Synonyms GA_x6K02T2Q125-72673494-72672556, Olfr1297, MOR248-4
MMRRC Submission 045791-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7735 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 111451479-111452417 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 111451819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 200 (N200I)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000213398]
AlphaFold Q8VGE8
Predicted Effect probably damaging
Transcript: ENSMUST00000099612
AA Change: N200I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: N200I

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213398
AA Change: N200I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,655,629 (GRCm39) T617A probably benign Het
Agl A T 3: 116,578,795 (GRCm39) I446N probably benign Het
Aox1 C T 1: 58,107,451 (GRCm39) P575L probably benign Het
Ap2m1 A T 16: 20,358,269 (GRCm39) I96F probably benign Het
Arhgap15 A G 2: 44,006,642 (GRCm39) D253G probably damaging Het
Arsa A T 15: 89,359,152 (GRCm39) C171* probably null Het
Arsb G T 13: 93,908,491 (GRCm39) R69L probably benign Het
Asb13 G A 13: 3,684,180 (GRCm39) probably null Het
Canx G T 11: 50,191,866 (GRCm39) D348E probably damaging Het
Cebpz C T 17: 79,233,342 (GRCm39) probably null Het
Ces2h A T 8: 105,741,127 (GRCm39) I40L probably benign Het
Cfhr4 A G 1: 139,660,039 (GRCm39) probably null Het
Csmd2 T C 4: 128,350,723 (GRCm39) probably null Het
Cxadr T A 16: 78,125,949 (GRCm39) N106K possibly damaging Het
Ddo T C 10: 40,507,770 (GRCm39) C56R probably benign Het
Dnah6 C T 6: 73,046,412 (GRCm39) G3192D probably damaging Het
Efcab3 T A 11: 104,962,465 (GRCm39) V49E probably benign Het
Epha10 T C 4: 124,807,472 (GRCm39) Y578H Het
Fbxw16 T C 9: 109,270,135 (GRCm39) D202G probably damaging Het
Gzf1 T C 2: 148,530,083 (GRCm39) V538A possibly damaging Het
Igha T A 12: 113,220,019 (GRCm39) probably benign Het
Iqce G T 5: 140,663,839 (GRCm39) Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 (GRCm39) K407E possibly damaging Het
Lipt1 A G 1: 37,914,703 (GRCm39) E253G probably damaging Het
Mrnip G A 11: 50,087,800 (GRCm39) W107* probably null Het
Mroh4 T C 15: 74,497,357 (GRCm39) T224A probably damaging Het
Ncoa2 A T 1: 13,218,661 (GRCm39) S1389R probably benign Het
Npffr2 A G 5: 89,731,173 (GRCm39) I368V probably benign Het
Nrdc C T 4: 108,895,182 (GRCm39) L469F probably damaging Het
Nup210l A T 3: 90,092,883 (GRCm39) Q1279L probably damaging Het
Or7e170 A G 9: 19,795,410 (GRCm39) Y64H probably damaging Het
Pcdha4 T G 18: 37,085,961 (GRCm39) I48S probably damaging Het
Pip5kl1 A G 2: 32,469,101 (GRCm39) Y211C possibly damaging Het
Prrt4 A T 6: 29,170,035 (GRCm39) S806T possibly damaging Het
Ptpn20 T A 14: 33,352,902 (GRCm39) Y214N probably damaging Het
Ptprt A T 2: 161,417,661 (GRCm39) N938K probably damaging Het
Scn2a G T 2: 65,594,013 (GRCm39) V1621L probably benign Het
Senp3 A G 11: 69,569,087 (GRCm39) I358T probably damaging Het
Sf3b1 A T 1: 55,042,508 (GRCm39) S461T probably benign Het
Slc22a2 C T 17: 12,828,917 (GRCm39) T341I probably damaging Het
Slc38a7 A T 8: 96,568,295 (GRCm39) D363E probably benign Het
Slc6a5 T C 7: 49,598,090 (GRCm39) probably null Het
Smo T A 6: 29,759,851 (GRCm39) V650E probably damaging Het
Spata17 G A 1: 186,872,577 (GRCm39) T31I unknown Het
Sstr2 T A 11: 113,515,423 (GRCm39) I114N possibly damaging Het
Styxl1 T C 5: 135,788,023 (GRCm39) Y146C probably damaging Het
Synpo2l T C 14: 20,711,243 (GRCm39) Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 (GRCm39) R322H probably benign Het
Tnxb A G 17: 34,890,398 (GRCm39) E247G unknown Het
Ttc28 A T 5: 111,414,544 (GRCm39) probably null Het
Ttn A T 2: 76,718,416 (GRCm39) I7255N unknown Het
Ttn C A 2: 76,652,768 (GRCm39) probably null Het
Unc13b C T 4: 43,165,791 (GRCm39) R204C probably damaging Het
Utrn A G 10: 12,619,787 (GRCm39) probably null Het
Vps53 A T 11: 75,937,962 (GRCm39) F753I probably damaging Het
Ypel1 G T 16: 16,918,124 (GRCm39) S97R probably benign Het
Zdbf2 A G 1: 63,343,264 (GRCm39) T548A possibly damaging Het
Zfp747 G A 7: 126,973,672 (GRCm39) T166M probably damaging Het
Other mutations in Or4k47
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Or4k47 APN 2 111,451,685 (GRCm39) missense probably damaging 1.00
IGL01305:Or4k47 APN 2 111,451,546 (GRCm39) missense probably damaging 1.00
IGL01903:Or4k47 APN 2 111,452,003 (GRCm39) missense probably benign 0.01
IGL01984:Or4k47 APN 2 111,451,927 (GRCm39) missense probably benign 0.34
IGL03065:Or4k47 APN 2 111,451,535 (GRCm39) missense probably damaging 0.98
ANU22:Or4k47 UTSW 2 111,451,546 (GRCm39) missense probably damaging 1.00
R0313:Or4k47 UTSW 2 111,451,945 (GRCm39) missense possibly damaging 0.77
R0615:Or4k47 UTSW 2 111,452,264 (GRCm39) missense possibly damaging 0.95
R1028:Or4k47 UTSW 2 111,451,870 (GRCm39) missense probably damaging 1.00
R1078:Or4k47 UTSW 2 111,451,690 (GRCm39) missense probably damaging 1.00
R1158:Or4k47 UTSW 2 111,452,086 (GRCm39) missense probably damaging 1.00
R1419:Or4k47 UTSW 2 111,451,640 (GRCm39) missense probably benign 0.05
R1980:Or4k47 UTSW 2 111,451,586 (GRCm39) missense probably benign 0.00
R1981:Or4k47 UTSW 2 111,451,586 (GRCm39) missense probably benign 0.00
R2044:Or4k47 UTSW 2 111,452,159 (GRCm39) missense probably benign 0.02
R2080:Or4k47 UTSW 2 111,452,084 (GRCm39) missense probably benign
R2170:Or4k47 UTSW 2 111,451,945 (GRCm39) missense possibly damaging 0.77
R4494:Or4k47 UTSW 2 111,451,493 (GRCm39) nonsense probably null
R4965:Or4k47 UTSW 2 111,451,879 (GRCm39) missense probably damaging 1.00
R5175:Or4k47 UTSW 2 111,451,771 (GRCm39) missense possibly damaging 0.78
R5891:Or4k47 UTSW 2 111,451,778 (GRCm39) missense probably damaging 1.00
R6192:Or4k47 UTSW 2 111,451,520 (GRCm39) missense possibly damaging 0.91
R6383:Or4k47 UTSW 2 111,451,531 (GRCm39) missense probably benign 0.10
R6730:Or4k47 UTSW 2 111,452,080 (GRCm39) missense probably damaging 0.96
R7189:Or4k47 UTSW 2 111,451,538 (GRCm39) missense probably benign 0.03
R7193:Or4k47 UTSW 2 111,451,600 (GRCm39) missense probably damaging 1.00
R7199:Or4k47 UTSW 2 111,451,538 (GRCm39) missense probably benign 0.01
R8017:Or4k47 UTSW 2 111,452,412 (GRCm39) missense probably benign 0.00
R8019:Or4k47 UTSW 2 111,452,412 (GRCm39) missense probably benign 0.00
R8285:Or4k47 UTSW 2 111,452,390 (GRCm39) missense probably benign 0.32
R8419:Or4k47 UTSW 2 111,451,849 (GRCm39) missense probably benign 0.10
R9258:Or4k47 UTSW 2 111,452,329 (GRCm39) missense possibly damaging 0.77
X0063:Or4k47 UTSW 2 111,451,726 (GRCm39) missense probably benign 0.04
Z1176:Or4k47 UTSW 2 111,451,606 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAACCAGGTGATATTTAGGG -3'
(R):5'- CATGAACTTGAAGAGGTGCACTG -3'

Sequencing Primer
(F):5'- CCAACCAGGTGATATTTAGGGGAAAC -3'
(R):5'- AAGAGGTGCACTGGGTTG -3'
Posted On 2019-11-26