Incidental Mutation 'R7735:Olfr1297'
ID596178
Institutional Source Beutler Lab
Gene Symbol Olfr1297
Ensembl Gene ENSMUSG00000094858
Gene Nameolfactory receptor 1297
SynonymsGA_x6K02T2Q125-72673494-72672556, MOR248-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock #R7735 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location111615233-111626497 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111621474 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 200 (N200I)
Ref Sequence ENSEMBL: ENSMUSP00000150543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099612] [ENSMUST00000213398]
Predicted Effect probably damaging
Transcript: ENSMUST00000099612
AA Change: N200I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097207
Gene: ENSMUSG00000094858
AA Change: N200I

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 4.8e-48 PFAM
Pfam:7tm_1 41 287 6.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213398
AA Change: N200I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Olfr1297
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Olfr1297 APN 2 111621340 missense probably damaging 1.00
IGL01305:Olfr1297 APN 2 111621201 missense probably damaging 1.00
IGL01903:Olfr1297 APN 2 111621658 missense probably benign 0.01
IGL01984:Olfr1297 APN 2 111621582 missense probably benign 0.34
IGL03065:Olfr1297 APN 2 111621190 missense probably damaging 0.98
ANU22:Olfr1297 UTSW 2 111621201 missense probably damaging 1.00
R0313:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R0615:Olfr1297 UTSW 2 111621919 missense possibly damaging 0.95
R1028:Olfr1297 UTSW 2 111621525 missense probably damaging 1.00
R1078:Olfr1297 UTSW 2 111621345 missense probably damaging 1.00
R1158:Olfr1297 UTSW 2 111621741 missense probably damaging 1.00
R1419:Olfr1297 UTSW 2 111621295 missense probably benign 0.05
R1980:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R1981:Olfr1297 UTSW 2 111621241 missense probably benign 0.00
R2044:Olfr1297 UTSW 2 111621814 missense probably benign 0.02
R2080:Olfr1297 UTSW 2 111621739 missense probably benign
R2170:Olfr1297 UTSW 2 111621600 missense possibly damaging 0.77
R4494:Olfr1297 UTSW 2 111621148 nonsense probably null
R4965:Olfr1297 UTSW 2 111621534 missense probably damaging 1.00
R5175:Olfr1297 UTSW 2 111621426 missense possibly damaging 0.78
R5891:Olfr1297 UTSW 2 111621433 missense probably damaging 1.00
R6192:Olfr1297 UTSW 2 111621175 missense possibly damaging 0.91
R6383:Olfr1297 UTSW 2 111621186 missense probably benign 0.10
R6730:Olfr1297 UTSW 2 111621735 missense probably damaging 0.96
R7189:Olfr1297 UTSW 2 111621193 missense probably benign 0.03
R7193:Olfr1297 UTSW 2 111621255 missense probably damaging 1.00
R7199:Olfr1297 UTSW 2 111621193 missense probably benign 0.01
R8019:Olfr1297 UTSW 2 111622067 missense probably benign 0.00
X0063:Olfr1297 UTSW 2 111621381 missense probably benign 0.04
Z1176:Olfr1297 UTSW 2 111621261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAACCAGGTGATATTTAGGG -3'
(R):5'- CATGAACTTGAAGAGGTGCACTG -3'

Sequencing Primer
(F):5'- CCAACCAGGTGATATTTAGGGGAAAC -3'
(R):5'- AAGAGGTGCACTGGGTTG -3'
Posted On2019-11-26