Incidental Mutation 'R0242:Myo5b'
ID59618
Institutional Source Beutler Lab
Gene Symbol Myo5b
Ensembl Gene ENSMUSG00000025885
Gene Namemyosin VB
Synonyms
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R0242 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location74440936-74771493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74661716 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 552 (H552R)
Ref Sequence ENSEMBL: ENSMUSP00000112728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074157] [ENSMUST00000121875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074157
AA Change: H552R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000073790
Gene: ENSMUSG00000025885
AA Change: H552R

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1311 1415 N/A INTRINSIC
DIL 1650 1755 7.48e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120161
Predicted Effect possibly damaging
Transcript: ENSMUST00000121875
AA Change: H552R

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112728
Gene: ENSMUSG00000025885
AA Change: H552R

DomainStartEndE-ValueType
MYSc 63 763 N/A SMART
IQ 764 786 2.41e-4 SMART
IQ 787 809 7.7e-3 SMART
IQ 812 834 2.18e-2 SMART
IQ 835 857 1.72e0 SMART
IQ 860 882 7.52e-6 SMART
IQ 883 905 4.12e-3 SMART
low complexity region 1053 1065 N/A INTRINSIC
coiled coil region 1140 1261 N/A INTRINSIC
coiled coil region 1332 1441 N/A INTRINSIC
DIL 1676 1781 7.48e-51 SMART
Meta Mutation Damage Score 0.56 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, together with other proteins, may be involved in plasma membrane recycling. Mutations in this gene are associated with microvillous inclusion disease. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice show perinatal mortality, diarrhea, intestinal microvillus atrophy and the presence of microvillus inclusion bodies, resembling phenotype of Microvillus Inclusion Disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Cdcp1 G T 9: 123,180,172 F480L probably benign Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Myo5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Myo5b APN 18 74654076 splice site probably benign
IGL01083:Myo5b APN 18 74733903 splice site probably benign
IGL01448:Myo5b APN 18 74644090 missense probably damaging 0.97
IGL01516:Myo5b APN 18 74627195 missense probably damaging 0.99
IGL01525:Myo5b APN 18 74740549 missense probably damaging 1.00
IGL01873:Myo5b APN 18 74580396 missense probably damaging 1.00
IGL01887:Myo5b APN 18 74714936 missense probably benign 0.41
IGL01953:Myo5b APN 18 74569767 missense possibly damaging 0.62
IGL01976:Myo5b APN 18 74698277 missense probably damaging 1.00
IGL02017:Myo5b APN 18 74716999 missense probably damaging 1.00
IGL02331:Myo5b APN 18 74638040 critical splice acceptor site probably null
IGL02624:Myo5b APN 18 74714939 missense probably damaging 0.98
IGL02707:Myo5b APN 18 74695367 splice site probably benign
IGL02806:Myo5b APN 18 74617080 critical splice donor site probably null
IGL03009:Myo5b APN 18 74760968 missense possibly damaging 0.54
IGL03061:Myo5b APN 18 74634559 missense probably benign 0.02
IGL03061:Myo5b APN 18 74580544 splice site probably benign
R6985_Myo5b_942 UTSW 18 74653361 missense possibly damaging 0.93
R0085:Myo5b UTSW 18 74701680 missense probably benign 0.21
R0114:Myo5b UTSW 18 74742171 missense probably benign 0.03
R0226:Myo5b UTSW 18 74742180 missense probably benign
R0242:Myo5b UTSW 18 74661716 missense possibly damaging 0.95
R0471:Myo5b UTSW 18 74728954 splice site probably benign
R0494:Myo5b UTSW 18 74653967 missense probably damaging 1.00
R0920:Myo5b UTSW 18 74625641 missense probably benign 0.09
R1144:Myo5b UTSW 18 74625587 missense probably damaging 1.00
R1177:Myo5b UTSW 18 74644072 missense probably damaging 1.00
R1387:Myo5b UTSW 18 74644201 splice site probably benign
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1468:Myo5b UTSW 18 74740503 missense probably damaging 0.99
R1555:Myo5b UTSW 18 74569782 missense probably damaging 1.00
R1587:Myo5b UTSW 18 74733990 missense probably benign
R1600:Myo5b UTSW 18 74713540 unclassified probably benign
R1639:Myo5b UTSW 18 74707916 missense probably benign 0.19
R1779:Myo5b UTSW 18 74742147 missense probably benign 0.06
R1806:Myo5b UTSW 18 74577609 missense possibly damaging 0.91
R1929:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2046:Myo5b UTSW 18 74577455 missense probably benign 0.28
R2093:Myo5b UTSW 18 74759192 missense probably damaging 0.98
R2270:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2272:Myo5b UTSW 18 74733925 missense probably damaging 0.99
R2298:Myo5b UTSW 18 74625605 missense probably damaging 1.00
R2433:Myo5b UTSW 18 74759087 missense probably damaging 1.00
R2888:Myo5b UTSW 18 74762618 missense probably damaging 1.00
R3824:Myo5b UTSW 18 74661655 missense probably benign 0.41
R3937:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3938:Myo5b UTSW 18 74716037 missense probably damaging 0.98
R3947:Myo5b UTSW 18 74695403 missense probably damaging 1.00
R3971:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3972:Myo5b UTSW 18 74740527 missense probably damaging 1.00
R3974:Myo5b UTSW 18 74634481 missense probably damaging 1.00
R4027:Myo5b UTSW 18 74759240 missense possibly damaging 0.67
R4080:Myo5b UTSW 18 74740488 missense probably benign
R4285:Myo5b UTSW 18 74714849 missense probably benign
R4308:Myo5b UTSW 18 74731740 missense possibly damaging 0.89
R4411:Myo5b UTSW 18 74698274 missense possibly damaging 0.89
R4415:Myo5b UTSW 18 74580408 missense probably damaging 1.00
R4516:Myo5b UTSW 18 74625674 missense probably damaging 1.00
R4690:Myo5b UTSW 18 74722462 missense probably damaging 0.97
R4781:Myo5b UTSW 18 74744681 missense possibly damaging 0.80
R4786:Myo5b UTSW 18 74695380 missense probably benign 0.01
R4796:Myo5b UTSW 18 74744630 missense possibly damaging 0.68
R4924:Myo5b UTSW 18 74695384 missense probably benign 0.19
R4972:Myo5b UTSW 18 74627193 missense probably damaging 0.98
R5004:Myo5b UTSW 18 74744773 critical splice donor site probably null
R5024:Myo5b UTSW 18 74716034 missense possibly damaging 0.90
R5043:Myo5b UTSW 18 74638153 critical splice donor site probably null
R5187:Myo5b UTSW 18 74701674 missense possibly damaging 0.68
R5232:Myo5b UTSW 18 74714932 missense probably damaging 0.99
R5254:Myo5b UTSW 18 74700606 missense possibly damaging 0.65
R5255:Myo5b UTSW 18 74662670 missense possibly damaging 0.94
R5715:Myo5b UTSW 18 74742175 missense possibly damaging 0.88
R5733:Myo5b UTSW 18 74654057 missense possibly damaging 0.93
R5797:Myo5b UTSW 18 74701521 missense probably benign
R5875:Myo5b UTSW 18 74707902 synonymous probably null
R6088:Myo5b UTSW 18 74720898 missense possibly damaging 0.89
R6104:Myo5b UTSW 18 74700679 missense probably benign 0.19
R6237:Myo5b UTSW 18 74742178 missense probably damaging 1.00
R6265:Myo5b UTSW 18 74577440 splice site probably null
R6267:Myo5b UTSW 18 74616991 missense probably damaging 1.00
R6328:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6330:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6331:Myo5b UTSW 18 74616993 missense probably damaging 1.00
R6347:Myo5b UTSW 18 74770385 missense probably benign 0.11
R6479:Myo5b UTSW 18 74617015 missense probably damaging 1.00
R6748:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6749:Myo5b UTSW 18 74701503 missense possibly damaging 0.80
R6750:Myo5b UTSW 18 74617035 missense possibly damaging 0.74
R6833:Myo5b UTSW 18 74770325 missense probably benign
R6876:Myo5b UTSW 18 74707955 missense probably benign
R6880:Myo5b UTSW 18 74722430 missense probably benign 0.02
R6902:Myo5b UTSW 18 74676685 missense possibly damaging 0.95
R6985:Myo5b UTSW 18 74653361 missense possibly damaging 0.93
R7039:Myo5b UTSW 18 74701528 missense probably benign 0.01
R7162:Myo5b UTSW 18 74695427 missense probably benign 0.02
R7345:Myo5b UTSW 18 74708024 missense possibly damaging 0.82
R7530:Myo5b UTSW 18 74731731 missense probably benign 0.00
R7564:Myo5b UTSW 18 74634511 missense possibly damaging 0.84
Z1088:Myo5b UTSW 18 74744749 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TGAACCCTCTGTCTACCAGGATGC -3'
(R):5'- GGCTGCTCCAGAAGGAATCCAAAC -3'

Sequencing Primer
(F):5'- ACCAGGATGCTTCCCTGC -3'
(R):5'- TACTGCTATTGGAGAGCAGCC -3'
Posted On2013-07-11