Mutagenetix > Incidental Mutation

Incidental Mutation 'R7735:Nup210l'

596181

Institutional Source

Beutler Lab

Gene Symbol

Nup210l

Ensembl Gene

ENSMUSG00000027939

Gene Name

nucleoporin 210-like

Synonyms

4930548O11Rik, R26-EGFP, Tg(Gt(ROSA)26Sor-EGFP)130910Eps

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.403) question?

Stock #

R7735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

90104132-90212048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 90185576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1279 (Q1279L)

Ref Sequence

ENSEMBL: ENSMUSP00000029548 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029548] [ENSMUST00000200410]

AlphaFold

Q9D2F7

Predicted Effect

probably damaging
Transcript: ENSMUST00000029548
AA Change: Q1279L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000029548
Gene: ENSMUSG00000027939
AA Change: Q1279L

Domain	Start	End	E-Value	Type
transmembrane domain	13	32	N/A	INTRINSIC
BID_2	457	536	2.05e1	SMART
Blast:S1	949	1023	2e-16	BLAST
BID_2	1077	1152	4.51e-11	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200410
AA Change: Q1279L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143368
Gene: ENSMUSG00000027939
AA Change: Q1279L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
BID_2	457	536	6.9e-2	SMART
Blast:S1	938	1023	9e-17	BLAST
BID_2	1077	1152	1.5e-13	SMART
Blast:BID_2	1468	1550	7e-15	BLAST
transmembrane domain	1807	1829	N/A	INTRINSIC

Meta Mutation Damage Score

0.2386

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgene insertion exhibit male infertility, asthenozoospermia, teratozoospermia, azoospermia, and seminiferous tubule degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,783,780	T617A	probably benign	Het
Agl	A	T	3: 116,785,146	I446N	probably benign	Het
Aox1	C	T	1: 58,068,292	P575L	probably benign	Het
Ap2m1	A	T	16: 20,539,519	I96F	probably benign	Het
Arhgap15	A	G	2: 44,116,630	D253G	probably damaging	Het
Arsa	A	T	15: 89,474,949	C171*	probably null	Het
Arsb	G	T	13: 93,771,983	R69L	probably benign	Het
Asb13	G	A	13: 3,634,180		probably null	Het
Canx	G	T	11: 50,301,039	D348E	probably damaging	Het
Cebpz	C	T	17: 78,925,913		probably null	Het
Ces2h	A	T	8: 105,014,495	I40L	probably benign	Het
Csmd2	T	C	4: 128,456,930		probably null	Het
Cxadr	T	A	16: 78,329,061	N106K	possibly damaging	Het
Ddo	T	C	10: 40,631,774	C56R	probably benign	Het
Dnah6	C	T	6: 73,069,429	G3192D	probably damaging	Het
Efcab3	T	A	11: 105,071,639	V49E	probably benign	Het
Epha10	T	C	4: 124,913,679	Y578H		Het
Fbxw16	T	C	9: 109,441,067	D202G	probably damaging	Het
Gm4788	A	G	1: 139,732,301		probably null	Het
Gzf1	T	C	2: 148,688,163	V538A	possibly damaging	Het
Igha	T	A	12: 113,256,399		probably benign	Het
Iqce	G	T	5: 140,678,084	Q457K	probably benign	Het
Kbtbd3	A	G	9: 4,330,846	K407E	possibly damaging	Het
Lipt1	A	G	1: 37,875,622	E253G	probably damaging	Het
Mrnip	G	A	11: 50,196,973	W107*	probably null	Het
Mroh4	T	C	15: 74,625,508	T224A	probably damaging	Het
Ncoa2	A	T	1: 13,148,437	S1389R	probably benign	Het
Npffr2	A	G	5: 89,583,314	I368V	probably benign	Het
Nrd1	C	T	4: 109,037,985	L469F	probably damaging	Het
Olfr1297	T	A	2: 111,621,474	N200I	probably damaging	Het
Olfr862	A	G	9: 19,884,114	Y64H	probably damaging	Het
Pcdha4	T	G	18: 36,952,908	I48S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,089	Y211C	possibly damaging	Het
Ppil2	G	T	16: 17,100,260	S97R	probably benign	Het
Prrt4	A	T	6: 29,170,036	S806T	possibly damaging	Het
Ptpn20	T	A	14: 33,630,945	Y214N	probably damaging	Het
Ptprt	A	T	2: 161,575,741	N938K	probably damaging	Het
Scn2a	G	T	2: 65,763,669	V1621L	probably benign	Het
Senp3	A	G	11: 69,678,261	I358T	probably damaging	Het
Sf3b1	A	T	1: 55,003,349	S461T	probably benign	Het
Slc22a2	C	T	17: 12,610,030	T341I	probably damaging	Het
Slc38a7	A	T	8: 95,841,667	D363E	probably benign	Het
Slc6a5	T	C	7: 49,948,342		probably null	Het
Smo	T	A	6: 29,759,852	V650E	probably damaging	Het
Spata17	G	A	1: 187,140,380	T31I	unknown	Het
Sstr2	T	A	11: 113,624,597	I114N	possibly damaging	Het
Styxl1	T	C	5: 135,759,169	Y146C	probably damaging	Het
Synpo2l	T	C	14: 20,661,175	Q688R	possibly damaging	Het
Tmem245	C	T	4: 56,925,155	R322H	probably benign	Het
Tnxb	A	G	17: 34,671,424	E247G	unknown	Het
Ttc28	A	T	5: 111,266,678		probably null	Het
Ttn	C	A	2: 76,822,424		probably null	Het
Ttn	A	T	2: 76,888,072	I7255N	unknown	Het
Unc13b	C	T	4: 43,165,791	R204C	probably damaging	Het
Utrn	A	G	10: 12,744,043		probably null	Het
Vps53	A	T	11: 76,047,136	F753I	probably damaging	Het
Zdbf2	A	G	1: 63,304,105	T548A	possibly damaging	Het
Zfp747	G	A	7: 127,374,500	T166M	probably damaging	Het

Other mutations in Nup210l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Nup210l	APN	3	90190849	splice site	probably benign
IGL00813:Nup210l	APN	3	90132418	missense	probably benign	0.00
IGL01375:Nup210l	APN	3	90159893	missense	probably damaging	0.96
IGL01731:Nup210l	APN	3	90154566	missense	probably damaging	1.00
IGL01786:Nup210l	APN	3	90122776	nonsense	probably null
IGL01958:Nup210l	APN	3	90203924	missense	possibly damaging	0.74
IGL02094:Nup210l	APN	3	90180213	critical splice donor site	probably null
IGL02120:Nup210l	APN	3	90136862	missense	probably damaging	1.00
IGL02313:Nup210l	APN	3	90122792	missense	probably damaging	1.00
IGL02336:Nup210l	APN	3	90181552	critical splice donor site	probably null
IGL02348:Nup210l	APN	3	90104164	utr 5 prime	probably benign
IGL02372:Nup210l	APN	3	90201971	missense	possibly damaging	0.80
IGL02557:Nup210l	APN	3	90124230	missense	probably damaging	1.00
IGL02559:Nup210l	APN	3	90159953	missense	probably benign	0.02
IGL02738:Nup210l	APN	3	90136850	missense	possibly damaging	0.80
IGL03231:Nup210l	APN	3	90189545	missense	probably damaging	1.00
IGL03257:Nup210l	APN	3	90180148	critical splice acceptor site	probably null
IGL03388:Nup210l	APN	3	90170044	missense	probably damaging	1.00
IGL03134:Nup210l	UTSW	3	90190887	missense	possibly damaging	0.85
R0003:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R0040:Nup210l	UTSW	3	90181905	missense	probably damaging	1.00
R0083:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0090:Nup210l	UTSW	3	90211779	missense	probably benign	0.00
R0108:Nup210l	UTSW	3	90189575	missense	probably damaging	1.00
R0142:Nup210l	UTSW	3	90172113	missense	probably damaging	1.00
R0306:Nup210l	UTSW	3	90207368	missense	probably benign	0.13
R0332:Nup210l	UTSW	3	90132309	splice site	probably benign
R0346:Nup210l	UTSW	3	90189438	missense	probably damaging	1.00
R0463:Nup210l	UTSW	3	90180211	missense	probably null	1.00
R0622:Nup210l	UTSW	3	90167740	missense	probably damaging	0.98
R0765:Nup210l	UTSW	3	90119877	missense	probably damaging	0.99
R0990:Nup210l	UTSW	3	90211925	missense	probably benign	0.00
R1014:Nup210l	UTSW	3	90170048	missense	possibly damaging	0.62
R1036:Nup210l	UTSW	3	90192940	splice site	probably benign
R1177:Nup210l	UTSW	3	90202003	missense	probably benign	0.11
R1183:Nup210l	UTSW	3	90159945	missense	probably benign	0.04
R1188:Nup210l	UTSW	3	90198179	missense	probably benign	0.16
R1457:Nup210l	UTSW	3	90190972	missense	possibly damaging	0.68
R1471:Nup210l	UTSW	3	90170562	missense	probably benign
R1627:Nup210l	UTSW	3	90144169	missense	probably benign	0.15
R1778:Nup210l	UTSW	3	90189486	missense	probably damaging	0.99
R1827:Nup210l	UTSW	3	90154557	missense	probably damaging	1.00
R1843:Nup210l	UTSW	3	90172086	missense	probably damaging	0.96
R1858:Nup210l	UTSW	3	90154499	missense	probably damaging	0.97
R1942:Nup210l	UTSW	3	90151237	missense	probably benign	0.01
R2015:Nup210l	UTSW	3	90185432	missense	probably damaging	1.00
R2113:Nup210l	UTSW	3	90190974	missense	possibly damaging	0.48
R2944:Nup210l	UTSW	3	90181545	missense	probably damaging	1.00
R3736:Nup210l	UTSW	3	90120013	missense	probably damaging	1.00
R3740:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3741:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3742:Nup210l	UTSW	3	90207394	missense	probably benign	0.08
R3771:Nup210l	UTSW	3	90119894	nonsense	probably null
R3773:Nup210l	UTSW	3	90119894	nonsense	probably null
R3879:Nup210l	UTSW	3	90185473	missense	probably damaging	1.00
R3882:Nup210l	UTSW	3	90124210	missense	probably benign	0.19
R3953:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3954:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3955:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R3956:Nup210l	UTSW	3	90193054	missense	possibly damaging	0.89
R4200:Nup210l	UTSW	3	90119911	missense	probably damaging	1.00
R4290:Nup210l	UTSW	3	90207326	missense	probably benign	0.00
R4328:Nup210l	UTSW	3	90175835	splice site	probably null
R4629:Nup210l	UTSW	3	90167875	missense	probably benign	0.21
R4629:Nup210l	UTSW	3	90190874	nonsense	probably null
R4897:Nup210l	UTSW	3	90193071	missense	probably damaging	1.00
R4906:Nup210l	UTSW	3	90170030	missense	probably benign	0.06
R4966:Nup210l	UTSW	3	90106901	missense	probably benign	0.00
R5004:Nup210l	UTSW	3	90180165	nonsense	probably null
R5237:Nup210l	UTSW	3	90180198	missense	probably benign	0.00
R5499:Nup210l	UTSW	3	90174370	missense	probably damaging	1.00
R5522:Nup210l	UTSW	3	90154665	missense	probably benign	0.10
R5627:Nup210l	UTSW	3	90144250	missense	probably damaging	0.97
R5678:Nup210l	UTSW	3	90190959	missense	probably damaging	0.99
R5726:Nup210l	UTSW	3	90129207	splice site	probably null
R5792:Nup210l	UTSW	3	90199857	missense	probably damaging	1.00
R6129:Nup210l	UTSW	3	90104176	missense	probably benign	0.00
R6272:Nup210l	UTSW	3	90170024	missense	possibly damaging	0.57
R6290:Nup210l	UTSW	3	90119909	nonsense	probably null
R6293:Nup210l	UTSW	3	90115064	missense	probably damaging	1.00
R6446:Nup210l	UTSW	3	90172068	missense	probably damaging	1.00
R6698:Nup210l	UTSW	3	90182508	missense	possibly damaging	0.57
R6855:Nup210l	UTSW	3	90136924	missense	probably benign	0.01
R6895:Nup210l	UTSW	3	90159924	missense	probably damaging	0.97
R6899:Nup210l	UTSW	3	90167897	missense	possibly damaging	0.77
R6978:Nup210l	UTSW	3	90154566	missense	possibly damaging	0.86
R6980:Nup210l	UTSW	3	90119927	missense	probably benign	0.04
R7038:Nup210l	UTSW	3	90159947	missense	probably damaging	1.00
R7273:Nup210l	UTSW	3	90118547	missense	probably benign	0.04
R7450:Nup210l	UTSW	3	90115188	critical splice donor site	probably null
R7514:Nup210l	UTSW	3	90210459	critical splice donor site	probably null
R7658:Nup210l	UTSW	3	90211993	missense	probably benign	0.43
R7772:Nup210l	UTSW	3	90159926	missense	probably damaging	1.00
R7800:Nup210l	UTSW	3	90134597	missense	probably damaging	1.00
R7840:Nup210l	UTSW	3	90122729	missense	probably benign	0.08
R7847:Nup210l	UTSW	3	90151123	missense	probably benign
R7848:Nup210l	UTSW	3	90203905	missense	probably benign	0.01
R8084:Nup210l	UTSW	3	90136058	missense	probably benign	0.15
R8121:Nup210l	UTSW	3	90115121	missense	probably damaging	1.00
R8421:Nup210l	UTSW	3	90203867	missense	probably damaging	1.00
R8458:Nup210l	UTSW	3	90185567	missense	probably null	1.00
R8701:Nup210l	UTSW	3	90122814	missense	probably benign	0.41
R8720:Nup210l	UTSW	3	90210374	missense	probably benign	0.00
R8770:Nup210l	UTSW	3	90118543	missense	probably damaging	1.00
R8896:Nup210l	UTSW	3	90118625	missense	probably damaging	1.00
R9033:Nup210l	UTSW	3	90198089	missense	probably benign
R9371:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9373:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9381:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9426:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9427:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9501:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9523:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9574:Nup210l	UTSW	3	90210386	missense	probably benign
R9612:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9654:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9660:Nup210l	UTSW	3	90198095	missense	probably benign	0.30
R9660:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9662:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9682:Nup210l	UTSW	3	90144162	missense	possibly damaging	0.79
R9729:Nup210l	UTSW	3	90199866	missense	probably benign	0.01
R9750:Nup210l	UTSW	3	90210352	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CCTGTGTGAGAAGCAAGCAC -3'
(R):5'- TAGGGTTACAGATGCGCAC -3'

Sequencing Primer
(F):5'- CCCAGGGATGCTTTCTCAG -3'
(R):5'- GTTACAGATGCGCACCCCTC -3'

Posted On

2019-11-26