Mutagenetix > Incidental Mutations

Incidental Mutation 'R7735:Csmd2'

596187

Institutional Source

Beutler Lab

Gene Symbol

Csmd2

Ensembl Gene

ENSMUSG00000028804

Gene Name

CUB and Sushi multiple domains 2

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.151) question?

Stock #

R7735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

127987857-128567656 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 128456930 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000138958 (fasta)

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000184063

Predicted Effect

probably null
Transcript: ENSMUST00000184063

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,783,780	T617A	probably benign	Het
Agl	A	T	3: 116,785,146	I446N	probably benign	Het
Aox1	C	T	1: 58,068,292	P575L	probably benign	Het
Ap2m1	A	T	16: 20,539,519	I96F	probably benign	Het
Arhgap15	A	G	2: 44,116,630	D253G	probably damaging	Het
Arsa	A	T	15: 89,474,949	C171*	probably null	Het
Arsb	G	T	13: 93,771,983	R69L	probably benign	Het
Asb13	G	A	13: 3,634,180		probably null	Het
Canx	G	T	11: 50,301,039	D348E	probably damaging	Het
Cebpz	C	T	17: 78,925,913		probably null	Het
Ces2h	A	T	8: 105,014,495	I40L	probably benign	Het
Cxadr	T	A	16: 78,329,061	N106K	possibly damaging	Het
Ddo	T	C	10: 40,631,774	C56R	probably benign	Het
Dnah6	C	T	6: 73,069,429	G3192D	probably damaging	Het
Efcab3	T	A	11: 105,071,639	V49E	probably benign	Het
Epha10	T	C	4: 124,913,679	Y578H		Het
Fbxw16	T	C	9: 109,441,067	D202G	probably damaging	Het
Gm4788	A	G	1: 139,732,301		probably null	Het
Gzf1	T	C	2: 148,688,163	V538A	possibly damaging	Het
Igha	T	A	12: 113,256,399		probably benign	Het
Iqce	G	T	5: 140,678,084	Q457K	probably benign	Het
Kbtbd3	A	G	9: 4,330,846	K407E	possibly damaging	Het
Lipt1	A	G	1: 37,875,622	E253G	probably damaging	Het
Mrnip	G	A	11: 50,196,973	W107*	probably null	Het
Mroh4	T	C	15: 74,625,508	T224A	probably damaging	Het
Ncoa2	A	T	1: 13,148,437	S1389R	probably benign	Het
Npffr2	A	G	5: 89,583,314	I368V	probably benign	Het
Nrd1	C	T	4: 109,037,985	L469F	probably damaging	Het
Nup210l	A	T	3: 90,185,576	Q1279L	probably damaging	Het
Olfr1297	T	A	2: 111,621,474	N200I	probably damaging	Het
Olfr862	A	G	9: 19,884,114	Y64H	probably damaging	Het
Pcdha4	T	G	18: 36,952,908	I48S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,089	Y211C	possibly damaging	Het
Ppil2	G	T	16: 17,100,260	S97R	probably benign	Het
Prrt4	A	T	6: 29,170,036	S806T	possibly damaging	Het
Ptpn20	T	A	14: 33,630,945	Y214N	probably damaging	Het
Ptprt	A	T	2: 161,575,741	N938K	probably damaging	Het
Scn2a	G	T	2: 65,763,669	V1621L	probably benign	Het
Senp3	A	G	11: 69,678,261	I358T	probably damaging	Het
Sf3b1	A	T	1: 55,003,349	S461T	probably benign	Het
Slc22a2	C	T	17: 12,610,030	T341I	probably damaging	Het
Slc38a7	A	T	8: 95,841,667	D363E	probably benign	Het
Slc6a5	T	C	7: 49,948,342		probably null	Het
Smo	T	A	6: 29,759,852	V650E	probably damaging	Het
Spata17	G	A	1: 187,140,380	T31I	unknown	Het
Sstr2	T	A	11: 113,624,597	I114N	possibly damaging	Het
Styxl1	T	C	5: 135,759,169	Y146C	probably damaging	Het
Synpo2l	T	C	14: 20,661,175	Q688R	possibly damaging	Het
Tmem245	C	T	4: 56,925,155	R322H	probably benign	Het
Tnxb	A	G	17: 34,671,424	E247G	unknown	Het
Ttc28	A	T	5: 111,266,678		probably null	Het
Ttn	C	A	2: 76,822,424		probably null	Het
Ttn	A	T	2: 76,888,072	I7255N	unknown	Het
Unc13b	C	T	4: 43,165,791	R204C	probably damaging	Het
Utrn	A	G	10: 12,744,043		probably null	Het
Vps53	A	T	11: 76,047,136	F753I	probably damaging	Het
Zdbf2	A	G	1: 63,304,105	T548A	possibly damaging	Het
Zfp747	G	A	7: 127,374,500	T166M	probably damaging	Het

Other mutations in Csmd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00519:Csmd2	APN	4	128483473	missense	probably benign	0.03
IGL01098:Csmd2	APN	4	128059052	missense	probably damaging	0.99
IGL01114:Csmd2	APN	4	128369130	missense	probably benign	0.04
IGL01364:Csmd2	APN	4	128414288	missense	probably benign	0.01
IGL01530:Csmd2	APN	4	128414301	missense	possibly damaging	0.66
IGL01582:Csmd2	APN	4	128563305	nonsense	probably null
IGL01670:Csmd2	APN	4	128513371	splice site	probably benign
IGL01707:Csmd2	APN	4	128383005	missense	possibly damaging	0.81
IGL01810:Csmd2	APN	4	128480845	splice site	probably benign
IGL01837:Csmd2	APN	4	128419570	missense	possibly damaging	0.92
IGL01924:Csmd2	APN	4	128559947	missense	unknown
IGL02013:Csmd2	APN	4	128321323	missense	possibly damaging	0.47
IGL02020:Csmd2	APN	4	128559879	missense	probably damaging	1.00
IGL02037:Csmd2	APN	4	128477470	splice site	probably benign
IGL02303:Csmd2	APN	4	128369008	missense	probably benign	0.01
IGL02317:Csmd2	APN	4	128463727	splice site	probably benign
IGL02322:Csmd2	APN	4	128463727	splice site	probably benign
IGL02338:Csmd2	APN	4	128395066	missense	possibly damaging	0.79
IGL02412:Csmd2	APN	4	128513372	splice site	probably benign
IGL02428:Csmd2	APN	4	128474816	missense	possibly damaging	0.82
IGL02491:Csmd2	APN	4	128534257	missense	probably benign
IGL02701:Csmd2	APN	4	128496141	missense	probably benign	0.17
IGL02801:Csmd2	APN	4	128552075	splice site	probably null
IGL02818:Csmd2	APN	4	128209728	missense	probably damaging	1.00
IGL02863:Csmd2	APN	4	128521884	missense	probably benign	0.00
IGL02876:Csmd2	APN	4	128321335	nonsense	probably null
IGL02977:Csmd2	APN	4	128493276	nonsense	probably null
IGL03006:Csmd2	APN	4	128480765	splice site	probably benign
IGL03032:Csmd2	APN	4	128519041	missense	probably benign	0.03
IGL03148:Csmd2	APN	4	128384269	missense	probably damaging	1.00
IGL03157:Csmd2	APN	4	128414299	nonsense	probably null
IGL03245:Csmd2	APN	4	128509122	missense	probably benign	0.12
IGL03376:Csmd2	APN	4	128517671	missense	probably benign	0.03
IGL03014:Csmd2	UTSW	4	128296429	missense	probably benign	0.01
R0109:Csmd2	UTSW	4	128544743	missense	probably benign	0.03
R0112:Csmd2	UTSW	4	128496029	missense	probably damaging	1.00
R0157:Csmd2	UTSW	4	128521911	missense	probably benign	0.02
R0390:Csmd2	UTSW	4	128133673	intron	probably benign
R0441:Csmd2	UTSW	4	128520230	missense	probably benign	0.00
R0519:Csmd2	UTSW	4	128487005	missense	possibly damaging	0.95
R0743:Csmd2	UTSW	4	128113676	missense	probably benign	0.00
R0746:Csmd2	UTSW	4	128414297	missense	probably damaging	1.00
R0973:Csmd2	UTSW	4	128496188	missense	possibly damaging	0.91
R1019:Csmd2	UTSW	4	128522014	missense	probably benign	0.00
R1476:Csmd2	UTSW	4	128487001	missense	probably benign	0.08
R1641:Csmd2	UTSW	4	128483395	missense	possibly damaging	0.68
R1709:Csmd2	UTSW	4	128496195	missense	probably damaging	0.96
R2866:Csmd2	UTSW	4	128414392	critical splice donor site	probably null
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2870:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2871:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2872:Csmd2	UTSW	4	128557718	missense	unknown
R2873:Csmd2	UTSW	4	128557718	missense	unknown
R2893:Csmd2	UTSW	4	128538993	splice site	probably null
R3796:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3797:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3798:Csmd2	UTSW	4	128517595	missense	probably benign	0.20
R3914:Csmd2	UTSW	4	128321324	missense	probably benign	0.07
R4198:Csmd2	UTSW	4	128510924	missense	probably benign	0.07
R4489:Csmd2	UTSW	4	128381945	missense	possibly damaging	0.68
R4571:Csmd2	UTSW	4	128480095	splice site	probably null
R4581:Csmd2	UTSW	4	128369088	missense	probably benign	0.02
R4599:Csmd2	UTSW	4	127988128	missense	probably benign	0.35
R4649:Csmd2	UTSW	4	128546073	missense	probably benign
R4706:Csmd2	UTSW	4	128544751	missense	probably benign
R4776:Csmd2	UTSW	4	128442892	missense	probably benign	0.09
R4838:Csmd2	UTSW	4	128517749	missense	probably benign
R4900:Csmd2	UTSW	4	128452525	missense	probably benign	0.03
R4999:Csmd2	UTSW	4	128521930	missense	probably benign	0.00
R5024:Csmd2	UTSW	4	128321348	missense	possibly damaging	0.94
R5034:Csmd2	UTSW	4	128059108	missense	probably damaging	0.98
R5152:Csmd2	UTSW	4	128552035	missense	probably benign	0.27
R5172:Csmd2	UTSW	4	128477397	missense	probably benign	0.10
R5231:Csmd2	UTSW	4	128546049	missense	probably benign	0.00
R5279:Csmd2	UTSW	4	128456914	missense	probably benign	0.30
R5287:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5403:Csmd2	UTSW	4	128486884	missense	probably benign	0.01
R5410:Csmd2	UTSW	4	128548819	missense	probably benign
R5551:Csmd2	UTSW	4	128510948	missense	possibly damaging	0.83
R5566:Csmd2	UTSW	4	128462889	critical splice donor site	probably null
R5826:Csmd2	UTSW	4	128519199	splice site	probably null
R5907:Csmd2	UTSW	4	128197385	missense	probably damaging	0.99
R5913:Csmd2	UTSW	4	128551988	missense	probably benign	0.01
R5970:Csmd2	UTSW	4	128546151	missense	probably benign	0.00
R5977:Csmd2	UTSW	4	128059034	missense	probably damaging	1.00
R6027:Csmd2	UTSW	4	128559946	missense	unknown
R6075:Csmd2	UTSW	4	128486865	missense	probably benign	0.15
R6129:Csmd2	UTSW	4	128493334	missense	possibly damaging	0.79
R6363:Csmd2	UTSW	4	128400379	missense	probably benign	0.00
R6366:Csmd2	UTSW	4	128483452	missense	probably benign	0.00
R6404:Csmd2	UTSW	4	128521950	missense	possibly damaging	0.90
R6437:Csmd2	UTSW	4	127988100	missense	probably benign	0.24
R6441:Csmd2	UTSW	4	128394964	missense	probably benign	0.03
R6643:Csmd2	UTSW	4	128372597	missense	probably benign	0.14
R6724:Csmd2	UTSW	4	128563371	missense	probably damaging	0.97
R6734:Csmd2	UTSW	4	128463813	missense	probably benign	0.00
R6750:Csmd2	UTSW	4	128197225	missense	possibly damaging	0.91
R6801:Csmd2	UTSW	4	128383950	missense	probably benign	0.11
R6842:Csmd2	UTSW	4	128509159	missense	possibly damaging	0.72
R6843:Csmd2	UTSW	4	128463794	missense	probably benign	0.27
R6868:Csmd2	UTSW	4	128442840	missense	probably benign
R6882:Csmd2	UTSW	4	128449269	missense	probably benign	0.01
R7019:Csmd2	UTSW	4	128369063	missense
R7028:Csmd2	UTSW	4	128277228	missense
R7096:Csmd2	UTSW	4	128462726	missense
R7122:Csmd2	UTSW	4	128449227	missense
R7125:Csmd2	UTSW	4	128496162	missense
R7197:Csmd2	UTSW	4	128511033	missense
R7234:Csmd2	UTSW	4	128456779	missense
R7299:Csmd2	UTSW	4	128528262	missense
R7301:Csmd2	UTSW	4	128528262	missense
R7319:Csmd2	UTSW	4	128393679	missense
R7331:Csmd2	UTSW	4	128564228	splice site	probably null
R7332:Csmd2	UTSW	4	128419567	missense
R7352:Csmd2	UTSW	4	128557636	missense
R7402:Csmd2	UTSW	4	128322095	missense
R7402:Csmd2	UTSW	4	128322096	missense
R7474:Csmd2	UTSW	4	128546127	missense
R7555:Csmd2	UTSW	4	128452458	missense
R7592:Csmd2	UTSW	4	128463798	missense
R7700:Csmd2	UTSW	4	128545756	splice site	probably null
R7714:Csmd2	UTSW	4	128382950	nonsense	probably null
R7734:Csmd2	UTSW	4	128552057	missense
R7757:Csmd2	UTSW	4	128483456	missense
R7805:Csmd2	UTSW	4	128419573	missense
R7823:Csmd2	UTSW	4	128209905	missense
R7904:Csmd2	UTSW	4	128419553	missense
R7946:Csmd2	UTSW	4	128520265	missense
R7964:Csmd2	UTSW	4	128523510	missense
R7968:Csmd2	UTSW	4	128197325	missense
R8003:Csmd2	UTSW	4	128539187	nonsense	probably null
R8071:Csmd2	UTSW	4	128393538	missense
R8504:Csmd2	UTSW	4	128546690	missense
R8511:Csmd2	UTSW	4	128368899	missense
R8517:Csmd2	UTSW	4	128552686	missense
R8704:Csmd2	UTSW	4	128197354	missense
R8722:Csmd2	UTSW	4	128551950	unclassified	probably benign
R8729:Csmd2	UTSW	4	128462845	missense
R8801:Csmd2	UTSW	4	128563402	missense	probably damaging	0.97
R8803:Csmd2	UTSW	4	128546684	missense
R8839:Csmd2	UTSW	4	128442888	missense
R8867:Csmd2	UTSW	4	128557676	missense
R8913:Csmd2	UTSW	4	128523558	missense
R8928:Csmd2	UTSW	4	128475789	missense
R8974:Csmd2	UTSW	4	128552587	missense
R9001:Csmd2	UTSW	4	128414286	missense
R9132:Csmd2	UTSW	4	128549214	missense
R9245:Csmd2	UTSW	4	128306375	missense
R9249:Csmd2	UTSW	4	128419530	nonsense	probably null
R9254:Csmd2	UTSW	4	128197319	missense
R9265:Csmd2	UTSW	4	128400370	missense
R9407:Csmd2	UTSW	4	128548820	missense
R9432:Csmd2	UTSW	4	128277211	missense
Z1177:Csmd2	UTSW	4	128530797	missense

Predicted Primers

PCR Primer
(F):5'- AAACCCCTGTTTGACCTCCATG -3'
(R):5'- GCTCTTTTAGACCCAGGGTG -3'

Sequencing Primer
(F):5'- CCAGATTTAACTTGGAGCCTGGC -3'
(R):5'- ACCCAGGGTGTGTAAATATATAAGAC -3'

Posted On

2019-11-26