Incidental Mutation 'R7735:Dnah6'
ID596193
Institutional Source Beutler Lab
Gene Symbol Dnah6
Ensembl Gene ENSMUSG00000052861
Gene Namedynein, axonemal, heavy chain 6
SynonymsA730004I20Rik, Dnahc6
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7735 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location73017606-73221651 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73069429 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 3192 (G3192D)
Ref Sequence ENSEMBL: ENSMUSP00000068758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064948] [ENSMUST00000114040] [ENSMUST00000204053]
Predicted Effect probably damaging
Transcript: ENSMUST00000064948
AA Change: G3192D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068758
Gene: ENSMUSG00000052861
AA Change: G3192D

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114040
AA Change: G3140D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109674
Gene: ENSMUSG00000052861
AA Change: G3140D

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 873 1300 2.2e-135 PFAM
AAA 1407 1510 2.76e-1 SMART
AAA 1688 1829 5.25e-1 SMART
low complexity region 1905 1915 N/A INTRINSIC
AAA 2031 2184 1.01e-3 SMART
AAA 2382 2540 3.08e0 SMART
low complexity region 2555 2566 N/A INTRINSIC
low complexity region 2593 2604 N/A INTRINSIC
Pfam:MT 2633 2967 1.1e-53 PFAM
Pfam:AAA_9 2984 3214 1e-58 PFAM
Pfam:Dynein_heavy 3344 4089 2.2e-213 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204053
AA Change: G3192D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144791
Gene: ENSMUSG00000052861
AA Change: G3192D

DomainStartEndE-ValueType
coiled coil region 732 759 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
Pfam:DHC_N2 875 1298 4.3e-144 PFAM
AAA 1459 1562 2.76e-1 SMART
AAA 1740 1881 5.25e-1 SMART
low complexity region 1957 1967 N/A INTRINSIC
AAA 2083 2236 1.01e-3 SMART
AAA 2434 2592 3.08e0 SMART
low complexity region 2607 2618 N/A INTRINSIC
low complexity region 2645 2656 N/A INTRINSIC
Pfam:MT 2685 3019 3.1e-53 PFAM
Pfam:AAA_9 3040 3265 3.6e-94 PFAM
Pfam:Dynein_heavy 3402 4140 1.2e-250 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the dynein family, whose members encode large proteins that are constituents of the microtubule-associated motor protein complex. This complex is composed of dynein heavy, intermediate and light chains, which can be axonemal or cytoplasmic. This protein is an axonemal dynein heavy chain. It is involved in producing force for ciliary beating by using energy from ATP hydrolysis. Mutations in this gene may cause primary ciliary dyskinesia (PCD) as well as heterotaxy. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Asb13 G A 13: 3,634,180 probably null Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttc28 A T 5: 111,266,678 probably null Het
Ttn C A 2: 76,822,424 probably null Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Dnah6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Dnah6 APN 6 73195737 missense probably benign 0.00
IGL00488:Dnah6 APN 6 73086207 missense possibly damaging 0.95
IGL00497:Dnah6 APN 6 73195761 missense probably damaging 1.00
IGL00557:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00561:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00563:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00755:Dnah6 APN 6 73212434 critical splice donor site probably null
IGL00756:Dnah6 APN 6 73123771 missense possibly damaging 0.76
IGL00764:Dnah6 APN 6 73195620 missense possibly damaging 0.47
IGL00895:Dnah6 APN 6 73156350 missense possibly damaging 0.67
IGL00922:Dnah6 APN 6 73033526 splice site probably benign
IGL00972:Dnah6 APN 6 73083157 splice site probably benign
IGL00975:Dnah6 APN 6 73173390 missense possibly damaging 0.94
IGL01014:Dnah6 APN 6 73074781 splice site probably benign
IGL01307:Dnah6 APN 6 73065725 missense probably damaging 1.00
IGL01353:Dnah6 APN 6 73173456 missense probably benign 0.01
IGL01362:Dnah6 APN 6 73092178 missense probably damaging 1.00
IGL01373:Dnah6 APN 6 73074748 missense probably benign 0.10
IGL01559:Dnah6 APN 6 73024252 critical splice donor site probably null
IGL01622:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01623:Dnah6 APN 6 73144718 missense probably damaging 1.00
IGL01682:Dnah6 APN 6 73075802 missense probably damaging 1.00
IGL01735:Dnah6 APN 6 73076660 nonsense probably null
IGL01736:Dnah6 APN 6 73188377 missense probably benign 0.06
IGL01825:Dnah6 APN 6 73065776 missense probably damaging 1.00
IGL01835:Dnah6 APN 6 73135801 missense probably damaging 1.00
IGL01870:Dnah6 APN 6 73032569 missense probably benign 0.04
IGL01935:Dnah6 APN 6 73060143 missense probably benign
IGL02126:Dnah6 APN 6 73103166 missense probably benign 0.01
IGL02191:Dnah6 APN 6 73017797 missense probably benign 0.00
IGL02293:Dnah6 APN 6 73133650 splice site probably benign
IGL02316:Dnah6 APN 6 73168911 missense probably benign 0.19
IGL02339:Dnah6 APN 6 73101898 missense probably benign 0.00
IGL02380:Dnah6 APN 6 73076640 missense probably benign 0.12
IGL02458:Dnah6 APN 6 73027448 missense probably benign 0.43
IGL02499:Dnah6 APN 6 73021227 missense probably benign 0.12
IGL02652:Dnah6 APN 6 73095104 missense probably damaging 1.00
IGL02668:Dnah6 APN 6 73121823 missense possibly damaging 0.61
IGL02858:Dnah6 APN 6 73208599 missense probably benign 0.03
IGL02875:Dnah6 APN 6 73138715 missense probably damaging 0.99
IGL02878:Dnah6 APN 6 73032587 missense probably benign 0.01
IGL02989:Dnah6 APN 6 73069420 missense probably damaging 1.00
IGL03001:Dnah6 APN 6 73149140 missense probably benign 0.19
IGL03135:Dnah6 APN 6 73145004 missense probably benign 0.00
IGL03145:Dnah6 APN 6 73041054 missense probably damaging 1.00
IGL03202:Dnah6 APN 6 73144700 missense probably damaging 1.00
IGL03282:Dnah6 APN 6 73053647 splice site probably benign
IGL03286:Dnah6 APN 6 73083085 missense probably damaging 1.00
IGL03372:Dnah6 APN 6 73075850 missense probably benign 0.15
P0025:Dnah6 UTSW 6 73163504 missense probably benign 0.00
PIT4305001:Dnah6 UTSW 6 73065755 missense probably benign 0.03
PIT4466001:Dnah6 UTSW 6 73208641 missense probably benign 0.00
PIT4480001:Dnah6 UTSW 6 73101880 missense probably benign 0.00
PIT4515001:Dnah6 UTSW 6 73114582 missense probably damaging 1.00
PIT4651001:Dnah6 UTSW 6 73060260 missense probably benign 0.02
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0103:Dnah6 UTSW 6 73092172 missense probably damaging 1.00
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0105:Dnah6 UTSW 6 73155279 missense probably damaging 0.99
R0127:Dnah6 UTSW 6 73038734 splice site probably benign
R0164:Dnah6 UTSW 6 73188535 splice site probably benign
R0165:Dnah6 UTSW 6 73021323 missense probably benign 0.01
R0183:Dnah6 UTSW 6 73082923 missense probably damaging 1.00
R0200:Dnah6 UTSW 6 73069420 missense probably damaging 1.00
R0304:Dnah6 UTSW 6 73159115 missense probably damaging 1.00
R0324:Dnah6 UTSW 6 73173558 missense possibly damaging 0.86
R0335:Dnah6 UTSW 6 73069399 splice site probably benign
R0345:Dnah6 UTSW 6 73021257 missense probably benign 0.12
R0357:Dnah6 UTSW 6 73188359 missense probably benign
R0362:Dnah6 UTSW 6 73208609 missense probably benign 0.06
R0377:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R0386:Dnah6 UTSW 6 73083124 missense probably damaging 0.99
R0547:Dnah6 UTSW 6 73044774 missense probably benign 0.15
R0639:Dnah6 UTSW 6 73022412 missense probably benign 0.02
R0673:Dnah6 UTSW 6 73123811 missense probably benign 0.01
R0690:Dnah6 UTSW 6 73129474 missense probably benign 0.01
R0708:Dnah6 UTSW 6 73212622 missense probably benign 0.05
R0711:Dnah6 UTSW 6 73087602 missense probably damaging 0.99
R0718:Dnah6 UTSW 6 73035293 missense possibly damaging 0.80
R0894:Dnah6 UTSW 6 73124757 missense probably benign 0.00
R0972:Dnah6 UTSW 6 73159193 missense possibly damaging 0.94
R1263:Dnah6 UTSW 6 73144965 missense probably damaging 0.99
R1298:Dnah6 UTSW 6 73159135 missense probably damaging 1.00
R1300:Dnah6 UTSW 6 73124709 missense probably benign 0.22
R1301:Dnah6 UTSW 6 73208545 critical splice donor site probably null
R1341:Dnah6 UTSW 6 73191619 missense probably benign 0.09
R1509:Dnah6 UTSW 6 73027442 missense probably damaging 1.00
R1519:Dnah6 UTSW 6 73049048 missense probably damaging 0.97
R1533:Dnah6 UTSW 6 73151553 missense probably benign
R1557:Dnah6 UTSW 6 73049131 nonsense probably null
R1591:Dnah6 UTSW 6 73076600 missense probably benign 0.01
R1602:Dnah6 UTSW 6 73067469 missense probably damaging 1.00
R1610:Dnah6 UTSW 6 73144963 missense probably benign 0.09
R1616:Dnah6 UTSW 6 73100112 missense probably benign 0.10
R1643:Dnah6 UTSW 6 73044752 missense possibly damaging 0.85
R1644:Dnah6 UTSW 6 73155296 missense probably benign 0.18
R1655:Dnah6 UTSW 6 73205732 missense possibly damaging 0.88
R1661:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1665:Dnah6 UTSW 6 73124778 missense probably benign 0.00
R1675:Dnah6 UTSW 6 73129540 missense probably damaging 1.00
R1734:Dnah6 UTSW 6 73044761 missense probably damaging 0.98
R1757:Dnah6 UTSW 6 73160982 missense probably damaging 1.00
R1794:Dnah6 UTSW 6 73024958 missense probably damaging 0.99
R1831:Dnah6 UTSW 6 73181797 missense possibly damaging 0.76
R1866:Dnah6 UTSW 6 73100088 missense probably benign 0.00
R1897:Dnah6 UTSW 6 73181762 missense probably benign 0.30
R1951:Dnah6 UTSW 6 73084721 nonsense probably null
R1978:Dnah6 UTSW 6 73121970 missense possibly damaging 0.51
R1987:Dnah6 UTSW 6 73095044 missense probably damaging 0.96
R1988:Dnah6 UTSW 6 73092192 missense probably damaging 1.00
R2012:Dnah6 UTSW 6 73067466 missense probably damaging 1.00
R2014:Dnah6 UTSW 6 73173419 missense probably damaging 0.98
R2022:Dnah6 UTSW 6 73027422 missense probably benign
R2041:Dnah6 UTSW 6 73073439 missense probably damaging 1.00
R2068:Dnah6 UTSW 6 73021182 missense probably benign 0.23
R2114:Dnah6 UTSW 6 73144035 missense probably damaging 1.00
R2152:Dnah6 UTSW 6 73049166 missense probably benign 0.32
R2163:Dnah6 UTSW 6 73089746 splice site probably null
R2193:Dnah6 UTSW 6 73138640 missense probably damaging 1.00
R2235:Dnah6 UTSW 6 73100085 missense probably damaging 0.96
R2276:Dnah6 UTSW 6 73113581 missense probably benign 0.15
R2292:Dnah6 UTSW 6 73021109 missense probably damaging 1.00
R2355:Dnah6 UTSW 6 73156421 missense possibly damaging 0.95
R2395:Dnah6 UTSW 6 73091967 splice site probably null
R2436:Dnah6 UTSW 6 73149173 missense probably benign 0.05
R2847:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R2848:Dnah6 UTSW 6 73129331 missense probably benign 0.41
R3033:Dnah6 UTSW 6 73173350 missense probably benign 0.03
R3429:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3430:Dnah6 UTSW 6 73121814 missense possibly damaging 0.95
R3499:Dnah6 UTSW 6 73032633 missense probably benign 0.21
R3811:Dnah6 UTSW 6 73191498 missense probably benign 0.00
R3852:Dnah6 UTSW 6 73127927 missense possibly damaging 0.82
R3975:Dnah6 UTSW 6 73121992 missense possibly damaging 0.93
R4164:Dnah6 UTSW 6 73089592 nonsense probably null
R4246:Dnah6 UTSW 6 73129448 missense probably benign 0.00
R4367:Dnah6 UTSW 6 73149484 missense possibly damaging 0.95
R4378:Dnah6 UTSW 6 73118026 missense probably benign 0.01
R4405:Dnah6 UTSW 6 73129291 missense probably benign 0.00
R4420:Dnah6 UTSW 6 73191479 missense probably benign
R4486:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R4512:Dnah6 UTSW 6 73178416 missense probably damaging 1.00
R4547:Dnah6 UTSW 6 73192405 missense probably benign
R4573:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4574:Dnah6 UTSW 6 73086181 missense probably damaging 1.00
R4590:Dnah6 UTSW 6 73152712 missense probably damaging 0.99
R4604:Dnah6 UTSW 6 73129660 missense possibly damaging 0.92
R4652:Dnah6 UTSW 6 73070597 missense probably benign
R4653:Dnah6 UTSW 6 73073457 missense possibly damaging 0.76
R4669:Dnah6 UTSW 6 73037688 missense probably damaging 1.00
R4674:Dnah6 UTSW 6 73192422 missense probably benign 0.04
R4712:Dnah6 UTSW 6 73025012 critical splice acceptor site probably null
R4788:Dnah6 UTSW 6 73129530 missense probably damaging 1.00
R4791:Dnah6 UTSW 6 73095074 missense probably benign 0.11
R4792:Dnah6 UTSW 6 73089668 missense probably damaging 0.99
R4801:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4802:Dnah6 UTSW 6 73089698 missense probably damaging 1.00
R4817:Dnah6 UTSW 6 73022424 missense probably benign 0.02
R4830:Dnah6 UTSW 6 73044762 missense possibly damaging 0.85
R4862:Dnah6 UTSW 6 73121788 missense probably damaging 0.99
R4916:Dnah6 UTSW 6 73192676 intron probably benign
R4948:Dnah6 UTSW 6 73053689 missense probably benign 0.00
R4953:Dnah6 UTSW 6 73188383 missense probably benign 0.19
R5000:Dnah6 UTSW 6 73144815 missense probably benign 0.26
R5036:Dnah6 UTSW 6 73044691 missense probably benign
R5044:Dnah6 UTSW 6 73037622 missense probably benign 0.41
R5143:Dnah6 UTSW 6 73181761 missense possibly damaging 0.91
R5157:Dnah6 UTSW 6 73195634 missense probably benign
R5186:Dnah6 UTSW 6 73067427 missense probably damaging 1.00
R5201:Dnah6 UTSW 6 73195732 missense possibly damaging 0.82
R5249:Dnah6 UTSW 6 73113488 missense probably damaging 1.00
R5272:Dnah6 UTSW 6 73127861 critical splice donor site probably null
R5330:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5331:Dnah6 UTSW 6 73074590 missense probably damaging 1.00
R5340:Dnah6 UTSW 6 73212620 missense probably benign
R5343:Dnah6 UTSW 6 73212616 missense probably benign
R5375:Dnah6 UTSW 6 73123855 missense probably damaging 1.00
R5380:Dnah6 UTSW 6 73037615 missense probably damaging 1.00
R5435:Dnah6 UTSW 6 73060138 missense probably benign 0.00
R5455:Dnah6 UTSW 6 73075734 missense probably benign 0.00
R5458:Dnah6 UTSW 6 73086185 missense probably damaging 1.00
R5463:Dnah6 UTSW 6 73092157 missense probably benign 0.04
R5484:Dnah6 UTSW 6 73092116 missense possibly damaging 0.95
R5513:Dnah6 UTSW 6 73190419 missense probably null 0.00
R5527:Dnah6 UTSW 6 73159229 missense probably benign
R5541:Dnah6 UTSW 6 73192988 missense possibly damaging 0.91
R5548:Dnah6 UTSW 6 73151689 missense probably damaging 1.00
R5680:Dnah6 UTSW 6 73149525 missense probably damaging 1.00
R5689:Dnah6 UTSW 6 73021227 missense probably benign 0.12
R5966:Dnah6 UTSW 6 73060279 missense probably benign 0.00
R5980:Dnah6 UTSW 6 73181722 missense probably benign 0.01
R6049:Dnah6 UTSW 6 73086166 missense probably benign 0.38
R6092:Dnah6 UTSW 6 73114697 missense possibly damaging 0.61
R6130:Dnah6 UTSW 6 73188494 missense probably benign 0.16
R6279:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6300:Dnah6 UTSW 6 73065815 missense probably damaging 1.00
R6301:Dnah6 UTSW 6 73086217 missense probably damaging 1.00
R6315:Dnah6 UTSW 6 73191605 missense probably benign 0.02
R6394:Dnah6 UTSW 6 73155418 nonsense probably null
R6470:Dnah6 UTSW 6 73074586 missense probably damaging 1.00
R6526:Dnah6 UTSW 6 73074704 missense probably benign 0.05
R6545:Dnah6 UTSW 6 73044732 missense probably damaging 1.00
R6583:Dnah6 UTSW 6 73173533 missense probably benign 0.02
R6609:Dnah6 UTSW 6 73053695 missense possibly damaging 0.52
R6638:Dnah6 UTSW 6 73035280 splice site probably null
R6640:Dnah6 UTSW 6 73024293 missense probably damaging 1.00
R6647:Dnah6 UTSW 6 73138760 missense probably damaging 1.00
R6744:Dnah6 UTSW 6 73037549 missense probably damaging 0.97
R6767:Dnah6 UTSW 6 73133608 missense probably benign 0.29
R6845:Dnah6 UTSW 6 73133542 missense probably damaging 1.00
R6913:Dnah6 UTSW 6 73212522 missense probably benign 0.00
R6918:Dnah6 UTSW 6 73181755 nonsense probably null
R6929:Dnah6 UTSW 6 73044773 missense probably damaging 0.96
R6981:Dnah6 UTSW 6 73021178 missense probably benign 0.00
R7065:Dnah6 UTSW 6 73087562 missense possibly damaging 0.87
R7139:Dnah6 UTSW 6 73135680 missense probably damaging 1.00
R7169:Dnah6 UTSW 6 73038746 missense probably damaging 1.00
R7202:Dnah6 UTSW 6 73181705 critical splice donor site probably null
R7203:Dnah6 UTSW 6 73173545 missense probably benign 0.00
R7315:Dnah6 UTSW 6 73084760 missense probably damaging 1.00
R7329:Dnah6 UTSW 6 73144722 nonsense probably null
R7387:Dnah6 UTSW 6 73212612 nonsense probably null
R7388:Dnah6 UTSW 6 73192317 missense possibly damaging 0.47
R7454:Dnah6 UTSW 6 73212492 missense probably damaging 1.00
R7520:Dnah6 UTSW 6 73127904 missense probably benign 0.04
R7524:Dnah6 UTSW 6 73118099 missense probably damaging 1.00
R7548:Dnah6 UTSW 6 73027440 missense probably damaging 1.00
R7570:Dnah6 UTSW 6 73149430 missense probably benign 0.01
R7604:Dnah6 UTSW 6 73092168 missense probably damaging 1.00
R7615:Dnah6 UTSW 6 73095206 missense possibly damaging 0.85
R7622:Dnah6 UTSW 6 73124759 missense possibly damaging 0.94
R7690:Dnah6 UTSW 6 73169080 splice site probably null
R7754:Dnah6 UTSW 6 73025720 missense probably benign 0.41
R7829:Dnah6 UTSW 6 73127919 nonsense probably null
R7904:Dnah6 UTSW 6 73135467 splice site probably null
R8034:Dnah6 UTSW 6 73129225 missense probably damaging 1.00
R8093:Dnah6 UTSW 6 73160913 missense probably damaging 1.00
R8120:Dnah6 UTSW 6 73025786 missense probably damaging 1.00
R8178:Dnah6 UTSW 6 73060225 missense probably benign 0.16
R8206:Dnah6 UTSW 6 73037566 nonsense probably null
R8214:Dnah6 UTSW 6 73044728 missense probably damaging 1.00
R8269:Dnah6 UTSW 6 73168827 critical splice donor site probably null
R8273:Dnah6 UTSW 6 73076599 missense probably benign 0.31
R8273:Dnah6 UTSW 6 73195681 missense probably benign 0.00
R8331:Dnah6 UTSW 6 73025000 missense probably benign 0.10
R8350:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8428:Dnah6 UTSW 6 73074651 missense probably benign 0.15
R8447:Dnah6 UTSW 6 73138774 missense probably damaging 0.99
R8450:Dnah6 UTSW 6 73195815 missense probably benign 0.41
R8517:Dnah6 UTSW 6 73178457 missense probably benign 0.16
R8523:Dnah6 UTSW 6 73095188 missense probably damaging 1.00
R8691:Dnah6 UTSW 6 73168867 missense not run
R8737:Dnah6 UTSW 6 73067445 missense possibly damaging 0.83
R8762:Dnah6 UTSW 6 73179828 missense not run
R8804:Dnah6 UTSW 6 73065773 missense not run
R8809:Dnah6 UTSW 6 73032563 missense not run
R8813:Dnah6 UTSW 6 73127954 missense not run
RF002:Dnah6 UTSW 6 73101889 missense probably benign
RF020:Dnah6 UTSW 6 73118057 missense probably benign 0.00
W0251:Dnah6 UTSW 6 73178518 missense possibly damaging 0.95
X0025:Dnah6 UTSW 6 73037673 missense probably damaging 1.00
X0025:Dnah6 UTSW 6 73191500 missense probably benign 0.01
Z1176:Dnah6 UTSW 6 73087783 missense possibly damaging 0.79
Z1176:Dnah6 UTSW 6 73133559 missense probably benign
Z1177:Dnah6 UTSW 6 73021237 missense probably benign 0.13
Z1177:Dnah6 UTSW 6 73032526 missense probably damaging 0.99
Z1177:Dnah6 UTSW 6 73041138 missense probably damaging 1.00
Z1177:Dnah6 UTSW 6 73155272 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGACCTCCTGTTTAGCTGTGAATTTG -3'
(R):5'- GCATAGTCAGACTAGGGATGC -3'

Sequencing Primer
(F):5'- TGTAACTCCAGCTCCGAGG -3'
(R):5'- ATAGTCAGACTAGGGATGCCTCTC -3'
Posted On2019-11-26