Incidental Mutation 'R7735:Sstr2'
ID 596208
Institutional Source Beutler Lab
Gene Symbol Sstr2
Ensembl Gene ENSMUSG00000047904
Gene Name somatostatin receptor 2
Synonyms SSTR-2, Smstr2, Smstr-2, sst2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.697) question?
Stock # R7735 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 113619342-113626028 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 113624597 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 114 (I114N)
Ref Sequence ENSEMBL: ENSMUSP00000102241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]
AlphaFold P30875
Predicted Effect possibly damaging
Transcript: ENSMUST00000067591
AA Change: I114N

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: I114N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 281 1.1e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 2.5e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 4.9e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106630
AA Change: I114N

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: I114N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.3e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 1.9e-20 PFAM
Pfam:7tm_1 60 312 1.4e-65 PFAM
Pfam:7TM_GPCR_Srv 119 328 4.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125890
SMART Domains Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
Pfam:Zip 7 200 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136392
Predicted Effect probably benign
Transcript: ENSMUST00000146031
SMART Domains Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146390
AA Change: I114N

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: I114N

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 51 284 1.8e-10 PFAM
Pfam:7TM_GPCR_Srsx 54 327 2.4e-20 PFAM
Pfam:7tm_1 60 312 3.1e-70 PFAM
Pfam:7TM_GPCR_Srv 118 329 5.7e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Asb13 G A 13: 3,634,180 probably null Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptpn20 T A 14: 33,630,945 Y214N probably damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttc28 A T 5: 111,266,678 probably null Het
Ttn C A 2: 76,822,424 probably null Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Sstr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Sstr2 APN 11 113624995 missense probably benign 0.22
IGL01555:Sstr2 APN 11 113625619 missense probably benign 0.32
IGL02173:Sstr2 APN 11 113625016 missense probably damaging 1.00
IGL02430:Sstr2 APN 11 113624804 missense probably damaging 0.99
chat UTSW 11 113624549 missense probably damaging 1.00
R0125:Sstr2 UTSW 11 113624477 missense probably damaging 1.00
R0565:Sstr2 UTSW 11 113625619 missense probably benign 0.32
R1227:Sstr2 UTSW 11 113624885 missense probably damaging 0.99
R1356:Sstr2 UTSW 11 113624894 missense probably damaging 1.00
R1992:Sstr2 UTSW 11 113624669 missense probably benign 0.03
R2504:Sstr2 UTSW 11 113624431 missense probably damaging 0.98
R2509:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2510:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R2511:Sstr2 UTSW 11 113624923 missense probably damaging 0.99
R4051:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4083:Sstr2 UTSW 11 113625245 missense probably benign 0.05
R4207:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R4208:Sstr2 UTSW 11 113624656 missense probably damaging 1.00
R5666:Sstr2 UTSW 11 113624713 missense probably damaging 1.00
R6264:Sstr2 UTSW 11 113625106 missense probably damaging 1.00
R6339:Sstr2 UTSW 11 113624549 missense probably damaging 1.00
R6443:Sstr2 UTSW 11 113625254 splice site probably null
R6968:Sstr2 UTSW 11 113624948 missense probably damaging 1.00
R7146:Sstr2 UTSW 11 113625353 missense probably damaging 1.00
R8057:Sstr2 UTSW 11 113624273 missense probably benign
R8086:Sstr2 UTSW 11 113625172 missense probably damaging 1.00
R8087:Sstr2 UTSW 11 113624675 missense probably damaging 1.00
R9076:Sstr2 UTSW 11 113624351 missense probably benign 0.00
R9194:Sstr2 UTSW 11 113624377 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACGTTCATCTACTTCGTGGTG -3'
(R):5'- CGGCGTATATCATGATGGGC -3'

Sequencing Primer
(F):5'- CATCTACTTCGTGGTGTGTGTTGTC -3'
(R):5'- CGTATATCATGATGGGCAAAATGAC -3'
Posted On 2019-11-26