Mutagenetix > Incidental Mutations

Incidental Mutation 'R7735:Sstr2'

596208

Institutional Source

Beutler Lab

Gene Symbol

Sstr2

Ensembl Gene

ENSMUSG00000047904

Gene Name

somatostatin receptor 2

Synonyms

SSTR-2, Smstr2, Smstr-2, sst2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.697) question?

Stock #

R7735 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

113619342-113626028 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 113624597 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 114 (I114N)

Ref Sequence

ENSEMBL: ENSMUSP00000102241 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067591] [ENSMUST00000106630] [ENSMUST00000125890] [ENSMUST00000136392] [ENSMUST00000146031] [ENSMUST00000146390]

AlphaFold

P30875

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067591
AA Change: I114N

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000068578
Gene: ENSMUSG00000047904
AA Change: I114N

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	281	1.1e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	2.5e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	4.9e-13	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106630
AA Change: I114N

PolyPhen 2 Score 0.755 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000102241
Gene: ENSMUSG00000047904
AA Change: I114N

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.3e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	1.9e-20	PFAM
Pfam:7tm_1	60	312	1.4e-65	PFAM
Pfam:7TM_GPCR_Srv	119	328	4.3e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125890

SMART Domains

Protein: ENSMUSP00000115472
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
Pfam:Zip	7	200	3.6e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000136392

Predicted Effect

probably benign
Transcript: ENSMUST00000146031

SMART Domains

Protein: ENSMUSP00000121286
Gene: ENSMUSG00000041654

Domain	Start	End	E-Value	Type
transmembrane domain	10	32	N/A	INTRINSIC
transmembrane domain	39	61	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146390
AA Change: I114N

PolyPhen 2 Score 0.661 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000138101
Gene: ENSMUSG00000047904
AA Change: I114N

Domain	Start	End	E-Value	Type
Pfam:7TM_GPCR_Srx	51	284	1.8e-10	PFAM
Pfam:7TM_GPCR_Srsx	54	327	2.4e-20	PFAM
Pfam:7tm_1	60	312	3.1e-70	PFAM
Pfam:7TM_GPCR_Srv	118	329	5.7e-13	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a receptor for somatostatin, which acts at many sites to inhibit the release of several hormones and other secretory proteins. The encoded protein is a member of the superfamily of receptors having seven transmembrane segments and is involved in many processes, including adenylyl cyclase inhibition, phosphotyrosine phosphatase stimulation, and inhibition of calcium entry and cell growth. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a null allele show elevated anxiety and locomotor and exploratory deficits. Homozygotes for a reporter allele show altered motor coordination, somatostatin-induced dopamine and glutamate release, retinal rod bipolar cells and EEG patterns, and reduced infarction after focal ischemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy8	T	C	15: 64,783,780	T617A	probably benign	Het
Agl	A	T	3: 116,785,146	I446N	probably benign	Het
Aox1	C	T	1: 58,068,292	P575L	probably benign	Het
Ap2m1	A	T	16: 20,539,519	I96F	probably benign	Het
Arhgap15	A	G	2: 44,116,630	D253G	probably damaging	Het
Arsa	A	T	15: 89,474,949	C171*	probably null	Het
Arsb	G	T	13: 93,771,983	R69L	probably benign	Het
Asb13	G	A	13: 3,634,180		probably null	Het
Canx	G	T	11: 50,301,039	D348E	probably damaging	Het
Cebpz	C	T	17: 78,925,913		probably null	Het
Ces2h	A	T	8: 105,014,495	I40L	probably benign	Het
Csmd2	T	C	4: 128,456,930		probably null	Het
Cxadr	T	A	16: 78,329,061	N106K	possibly damaging	Het
Ddo	T	C	10: 40,631,774	C56R	probably benign	Het
Dnah6	C	T	6: 73,069,429	G3192D	probably damaging	Het
Efcab3	T	A	11: 105,071,639	V49E	probably benign	Het
Epha10	T	C	4: 124,913,679	Y578H		Het
Fbxw16	T	C	9: 109,441,067	D202G	probably damaging	Het
Gm4788	A	G	1: 139,732,301		probably null	Het
Gzf1	T	C	2: 148,688,163	V538A	possibly damaging	Het
Igha	T	A	12: 113,256,399		probably benign	Het
Iqce	G	T	5: 140,678,084	Q457K	probably benign	Het
Kbtbd3	A	G	9: 4,330,846	K407E	possibly damaging	Het
Lipt1	A	G	1: 37,875,622	E253G	probably damaging	Het
Mrnip	G	A	11: 50,196,973	W107*	probably null	Het
Mroh4	T	C	15: 74,625,508	T224A	probably damaging	Het
Ncoa2	A	T	1: 13,148,437	S1389R	probably benign	Het
Npffr2	A	G	5: 89,583,314	I368V	probably benign	Het
Nrd1	C	T	4: 109,037,985	L469F	probably damaging	Het
Nup210l	A	T	3: 90,185,576	Q1279L	probably damaging	Het
Olfr1297	T	A	2: 111,621,474	N200I	probably damaging	Het
Olfr862	A	G	9: 19,884,114	Y64H	probably damaging	Het
Pcdha4	T	G	18: 36,952,908	I48S	probably damaging	Het
Pip5kl1	A	G	2: 32,579,089	Y211C	possibly damaging	Het
Ppil2	G	T	16: 17,100,260	S97R	probably benign	Het
Prrt4	A	T	6: 29,170,036	S806T	possibly damaging	Het
Ptpn20	T	A	14: 33,630,945	Y214N	probably damaging	Het
Ptprt	A	T	2: 161,575,741	N938K	probably damaging	Het
Scn2a	G	T	2: 65,763,669	V1621L	probably benign	Het
Senp3	A	G	11: 69,678,261	I358T	probably damaging	Het
Sf3b1	A	T	1: 55,003,349	S461T	probably benign	Het
Slc22a2	C	T	17: 12,610,030	T341I	probably damaging	Het
Slc38a7	A	T	8: 95,841,667	D363E	probably benign	Het
Slc6a5	T	C	7: 49,948,342		probably null	Het
Smo	T	A	6: 29,759,852	V650E	probably damaging	Het
Spata17	G	A	1: 187,140,380	T31I	unknown	Het
Styxl1	T	C	5: 135,759,169	Y146C	probably damaging	Het
Synpo2l	T	C	14: 20,661,175	Q688R	possibly damaging	Het
Tmem245	C	T	4: 56,925,155	R322H	probably benign	Het
Tnxb	A	G	17: 34,671,424	E247G	unknown	Het
Ttc28	A	T	5: 111,266,678		probably null	Het
Ttn	C	A	2: 76,822,424		probably null	Het
Ttn	A	T	2: 76,888,072	I7255N	unknown	Het
Unc13b	C	T	4: 43,165,791	R204C	probably damaging	Het
Utrn	A	G	10: 12,744,043		probably null	Het
Vps53	A	T	11: 76,047,136	F753I	probably damaging	Het
Zdbf2	A	G	1: 63,304,105	T548A	possibly damaging	Het
Zfp747	G	A	7: 127,374,500	T166M	probably damaging	Het

Other mutations in Sstr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00906:Sstr2	APN	11	113624995	missense	probably benign	0.22
IGL01555:Sstr2	APN	11	113625619	missense	probably benign	0.32
IGL02173:Sstr2	APN	11	113625016	missense	probably damaging	1.00
IGL02430:Sstr2	APN	11	113624804	missense	probably damaging	0.99
chat	UTSW	11	113624549	missense	probably damaging	1.00
R0125:Sstr2	UTSW	11	113624477	missense	probably damaging	1.00
R0565:Sstr2	UTSW	11	113625619	missense	probably benign	0.32
R1227:Sstr2	UTSW	11	113624885	missense	probably damaging	0.99
R1356:Sstr2	UTSW	11	113624894	missense	probably damaging	1.00
R1992:Sstr2	UTSW	11	113624669	missense	probably benign	0.03
R2504:Sstr2	UTSW	11	113624431	missense	probably damaging	0.98
R2509:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R2510:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R2511:Sstr2	UTSW	11	113624923	missense	probably damaging	0.99
R4051:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4083:Sstr2	UTSW	11	113625245	missense	probably benign	0.05
R4207:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R4208:Sstr2	UTSW	11	113624656	missense	probably damaging	1.00
R5666:Sstr2	UTSW	11	113624713	missense	probably damaging	1.00
R6264:Sstr2	UTSW	11	113625106	missense	probably damaging	1.00
R6339:Sstr2	UTSW	11	113624549	missense	probably damaging	1.00
R6443:Sstr2	UTSW	11	113625254	splice site	probably null
R6968:Sstr2	UTSW	11	113624948	missense	probably damaging	1.00
R7146:Sstr2	UTSW	11	113625353	missense	probably damaging	1.00
R8057:Sstr2	UTSW	11	113624273	missense	probably benign
R8086:Sstr2	UTSW	11	113625172	missense	probably damaging	1.00
R8087:Sstr2	UTSW	11	113624675	missense	probably damaging	1.00
R9076:Sstr2	UTSW	11	113624351	missense	probably benign	0.00
R9194:Sstr2	UTSW	11	113624377	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACGTTCATCTACTTCGTGGTG -3'
(R):5'- CGGCGTATATCATGATGGGC -3'

Sequencing Primer
(F):5'- CATCTACTTCGTGGTGTGTGTTGTC -3'
(R):5'- CGTATATCATGATGGGCAAAATGAC -3'

Posted On

2019-11-26