Incidental Mutation 'R7735:Igha'
ID 596209
Institutional Source Beutler Lab
Gene Symbol Igha
Ensembl Gene ENSMUSG00000095079
Gene Name immunoglobulin heavy constant alpha
Synonyms IgA, Igh-2
MMRRC Submission 045791-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.056) question?
Stock # R7735 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 113219824-113223856 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 113220019 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000178282
Predicted Effect probably benign
Transcript: ENSMUST00000194738
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (58/58)
MGI Phenotype PHENOTYPE: Homozygous null mice have no detectable levels of IgA, decreased levels of IgG3, and increased levels of most other classes of immunoglobulins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,655,629 (GRCm39) T617A probably benign Het
Agl A T 3: 116,578,795 (GRCm39) I446N probably benign Het
Aox1 C T 1: 58,107,451 (GRCm39) P575L probably benign Het
Ap2m1 A T 16: 20,358,269 (GRCm39) I96F probably benign Het
Arhgap15 A G 2: 44,006,642 (GRCm39) D253G probably damaging Het
Arsa A T 15: 89,359,152 (GRCm39) C171* probably null Het
Arsb G T 13: 93,908,491 (GRCm39) R69L probably benign Het
Asb13 G A 13: 3,684,180 (GRCm39) probably null Het
Canx G T 11: 50,191,866 (GRCm39) D348E probably damaging Het
Cebpz C T 17: 79,233,342 (GRCm39) probably null Het
Ces2h A T 8: 105,741,127 (GRCm39) I40L probably benign Het
Cfhr4 A G 1: 139,660,039 (GRCm39) probably null Het
Csmd2 T C 4: 128,350,723 (GRCm39) probably null Het
Cxadr T A 16: 78,125,949 (GRCm39) N106K possibly damaging Het
Ddo T C 10: 40,507,770 (GRCm39) C56R probably benign Het
Dnah6 C T 6: 73,046,412 (GRCm39) G3192D probably damaging Het
Efcab3 T A 11: 104,962,465 (GRCm39) V49E probably benign Het
Epha10 T C 4: 124,807,472 (GRCm39) Y578H Het
Fbxw16 T C 9: 109,270,135 (GRCm39) D202G probably damaging Het
Gzf1 T C 2: 148,530,083 (GRCm39) V538A possibly damaging Het
Iqce G T 5: 140,663,839 (GRCm39) Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 (GRCm39) K407E possibly damaging Het
Lipt1 A G 1: 37,914,703 (GRCm39) E253G probably damaging Het
Mrnip G A 11: 50,087,800 (GRCm39) W107* probably null Het
Mroh4 T C 15: 74,497,357 (GRCm39) T224A probably damaging Het
Ncoa2 A T 1: 13,218,661 (GRCm39) S1389R probably benign Het
Npffr2 A G 5: 89,731,173 (GRCm39) I368V probably benign Het
Nrdc C T 4: 108,895,182 (GRCm39) L469F probably damaging Het
Nup210l A T 3: 90,092,883 (GRCm39) Q1279L probably damaging Het
Or4k47 T A 2: 111,451,819 (GRCm39) N200I probably damaging Het
Or7e170 A G 9: 19,795,410 (GRCm39) Y64H probably damaging Het
Pcdha4 T G 18: 37,085,961 (GRCm39) I48S probably damaging Het
Pip5kl1 A G 2: 32,469,101 (GRCm39) Y211C possibly damaging Het
Prrt4 A T 6: 29,170,035 (GRCm39) S806T possibly damaging Het
Ptpn20 T A 14: 33,352,902 (GRCm39) Y214N probably damaging Het
Ptprt A T 2: 161,417,661 (GRCm39) N938K probably damaging Het
Scn2a G T 2: 65,594,013 (GRCm39) V1621L probably benign Het
Senp3 A G 11: 69,569,087 (GRCm39) I358T probably damaging Het
Sf3b1 A T 1: 55,042,508 (GRCm39) S461T probably benign Het
Slc22a2 C T 17: 12,828,917 (GRCm39) T341I probably damaging Het
Slc38a7 A T 8: 96,568,295 (GRCm39) D363E probably benign Het
Slc6a5 T C 7: 49,598,090 (GRCm39) probably null Het
Smo T A 6: 29,759,851 (GRCm39) V650E probably damaging Het
Spata17 G A 1: 186,872,577 (GRCm39) T31I unknown Het
Sstr2 T A 11: 113,515,423 (GRCm39) I114N possibly damaging Het
Styxl1 T C 5: 135,788,023 (GRCm39) Y146C probably damaging Het
Synpo2l T C 14: 20,711,243 (GRCm39) Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 (GRCm39) R322H probably benign Het
Tnxb A G 17: 34,890,398 (GRCm39) E247G unknown Het
Ttc28 A T 5: 111,414,544 (GRCm39) probably null Het
Ttn A T 2: 76,718,416 (GRCm39) I7255N unknown Het
Ttn C A 2: 76,652,768 (GRCm39) probably null Het
Unc13b C T 4: 43,165,791 (GRCm39) R204C probably damaging Het
Utrn A G 10: 12,619,787 (GRCm39) probably null Het
Vps53 A T 11: 75,937,962 (GRCm39) F753I probably damaging Het
Ypel1 G T 16: 16,918,124 (GRCm39) S97R probably benign Het
Zdbf2 A G 1: 63,343,264 (GRCm39) T548A possibly damaging Het
Zfp747 G A 7: 126,973,672 (GRCm39) T166M probably damaging Het
Other mutations in Igha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03014:Igha UTSW 12 113,222,713 (GRCm39) missense unknown
R0078:Igha UTSW 12 113,223,547 (GRCm39) splice site probably benign
R3973:Igha UTSW 12 113,219,972 (GRCm39) unclassified probably benign
R4131:Igha UTSW 12 113,222,449 (GRCm39) critical splice donor site probably benign
R4866:Igha UTSW 12 113,223,129 (GRCm39) missense probably benign 0.30
R5931:Igha UTSW 12 113,223,710 (GRCm39) missense probably benign 0.05
R6101:Igha UTSW 12 113,220,017 (GRCm39) unclassified probably benign
R8172:Igha UTSW 12 113,223,592 (GRCm39) missense
R8738:Igha UTSW 12 113,223,144 (GRCm39) missense probably damaging 1.00
R8951:Igha UTSW 12 113,222,684 (GRCm39) missense
R8985:Igha UTSW 12 113,222,611 (GRCm39) missense
R9803:Igha UTSW 12 113,222,759 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATCTCCATGACTGCCACCTG -3'
(R):5'- TCAAGAACTGCTGGGATTCC -3'

Sequencing Primer
(F):5'- TCTTTGCTGCCAAACGGG -3'
(R):5'- GGATTCCAGTCCCTTACCTGG -3'
Posted On 2019-11-26