Incidental Mutation 'R7735:Ptpn20'
ID596212
Institutional Source Beutler Lab
Gene Symbol Ptpn20
Ensembl Gene ENSMUSG00000021940
Gene Nameprotein tyrosine phosphatase, non-receptor type 20
Synonymstyp
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7735 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location33589207-33640754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33630945 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 214 (Y214N)
Ref Sequence ENSEMBL: ENSMUSP00000022508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022508] [ENSMUST00000226512] [ENSMUST00000227887]
Predicted Effect probably damaging
Transcript: ENSMUST00000022508
AA Change: Y214N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022508
Gene: ENSMUSG00000021940
AA Change: Y214N

DomainStartEndE-ValueType
low complexity region 12 35 N/A INTRINSIC
PTPc 164 420 1.12e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226512
Predicted Effect probably benign
Transcript: ENSMUST00000227887
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of classical tyrosine-specific protein tyrosine phosphatases. Many protein tyrosine phosphatases have been shown to regulate fundamental cellular processes. The encoded protein appears to be targeted to sites of actin polymerization. A pseudogene of this gene has been defined on chromosome 10. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T C 15: 64,783,780 T617A probably benign Het
Agl A T 3: 116,785,146 I446N probably benign Het
Aox1 C T 1: 58,068,292 P575L probably benign Het
Ap2m1 A T 16: 20,539,519 I96F probably benign Het
Arhgap15 A G 2: 44,116,630 D253G probably damaging Het
Arsa A T 15: 89,474,949 C171* probably null Het
Arsb G T 13: 93,771,983 R69L probably benign Het
Canx G T 11: 50,301,039 D348E probably damaging Het
Cebpz C T 17: 78,925,913 probably null Het
Ces2h A T 8: 105,014,495 I40L probably benign Het
Csmd2 T C 4: 128,456,930 probably null Het
Cxadr T A 16: 78,329,061 N106K possibly damaging Het
Ddo T C 10: 40,631,774 C56R probably benign Het
Dnah6 C T 6: 73,069,429 G3192D probably damaging Het
Efcab3 T A 11: 105,071,639 V49E probably benign Het
Epha10 T C 4: 124,913,679 Y578H Het
Fbxw16 T C 9: 109,441,067 D202G probably damaging Het
Gm4788 A G 1: 139,732,301 probably null Het
Gzf1 T C 2: 148,688,163 V538A possibly damaging Het
Igha T A 12: 113,256,399 probably benign Het
Iqce G T 5: 140,678,084 Q457K probably benign Het
Kbtbd3 A G 9: 4,330,846 K407E possibly damaging Het
Lipt1 A G 1: 37,875,622 E253G probably damaging Het
Mrnip G A 11: 50,196,973 W107* probably null Het
Mroh4 T C 15: 74,625,508 T224A probably damaging Het
Ncoa2 A T 1: 13,148,437 S1389R probably benign Het
Npffr2 A G 5: 89,583,314 I368V probably benign Het
Nrd1 C T 4: 109,037,985 L469F probably damaging Het
Nup210l A T 3: 90,185,576 Q1279L probably damaging Het
Olfr1297 T A 2: 111,621,474 N200I probably damaging Het
Olfr862 A G 9: 19,884,114 Y64H probably damaging Het
Pcdha4 T G 18: 36,952,908 I48S probably damaging Het
Pip5kl1 A G 2: 32,579,089 Y211C possibly damaging Het
Ppil2 G T 16: 17,100,260 S97R probably benign Het
Prrt4 A T 6: 29,170,036 S806T possibly damaging Het
Ptprt A T 2: 161,575,741 N938K probably damaging Het
Scn2a G T 2: 65,763,669 V1621L probably benign Het
Senp3 A G 11: 69,678,261 I358T probably damaging Het
Sf3b1 A T 1: 55,003,349 S461T probably benign Het
Slc22a2 C T 17: 12,610,030 T341I probably damaging Het
Slc38a7 A T 8: 95,841,667 D363E probably benign Het
Slc6a5 T C 7: 49,948,342 probably null Het
Smo T A 6: 29,759,852 V650E probably damaging Het
Spata17 G A 1: 187,140,380 T31I unknown Het
Sstr2 T A 11: 113,624,597 I114N possibly damaging Het
Styxl1 T C 5: 135,759,169 Y146C probably damaging Het
Synpo2l T C 14: 20,661,175 Q688R possibly damaging Het
Tmem245 C T 4: 56,925,155 R322H probably benign Het
Tnxb A G 17: 34,671,424 E247G unknown Het
Ttn A T 2: 76,888,072 I7255N unknown Het
Unc13b C T 4: 43,165,791 R204C probably damaging Het
Utrn A G 10: 12,744,043 probably null Het
Vps53 A T 11: 76,047,136 F753I probably damaging Het
Zdbf2 A G 1: 63,304,105 T548A possibly damaging Het
Zfp747 G A 7: 127,374,500 T166M probably damaging Het
Other mutations in Ptpn20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ptpn20 APN 14 33622619 missense probably benign 0.22
IGL01510:Ptpn20 APN 14 33638386 splice site probably null
R2057:Ptpn20 UTSW 14 33630985 missense probably damaging 0.98
R2262:Ptpn20 UTSW 14 33612311 missense probably benign
R3106:Ptpn20 UTSW 14 33612296 missense probably benign
R3430:Ptpn20 UTSW 14 33614528 missense possibly damaging 0.61
R4645:Ptpn20 UTSW 14 33631212 missense probably benign
R4928:Ptpn20 UTSW 14 33614489 missense probably benign 0.00
R4962:Ptpn20 UTSW 14 33614459 missense probably benign 0.02
R5087:Ptpn20 UTSW 14 33614441 missense possibly damaging 0.90
R5163:Ptpn20 UTSW 14 33631111 missense probably benign 0.07
R5275:Ptpn20 UTSW 14 33631192 missense probably benign 0.00
R6325:Ptpn20 UTSW 14 33631005 missense possibly damaging 0.52
R6651:Ptpn20 UTSW 14 33632940 missense probably damaging 1.00
R6831:Ptpn20 UTSW 14 33632925 missense probably damaging 1.00
R6903:Ptpn20 UTSW 14 33614504 missense probably damaging 0.98
R7034:Ptpn20 UTSW 14 33614435 makesense probably null
R7036:Ptpn20 UTSW 14 33614435 makesense probably null
R7265:Ptpn20 UTSW 14 33614524 missense probably benign 0.05
R7654:Ptpn20 UTSW 14 33638324 missense probably benign 0.18
R7761:Ptpn20 UTSW 14 33622552 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TTGGCTCTTTTGAAAGTAATCTCCC -3'
(R):5'- AAGGCTCCTTCAGAGAAATGG -3'

Sequencing Primer
(F):5'- CCCTTGTCATTTTCTTTTGAGAGAG -3'
(R):5'- TGGGCCAGTAACTGTAACACTTG -3'
Posted On2019-11-26