Incidental Mutation 'R7736:Abca12'
ID596224
Institutional Source Beutler Lab
Gene Symbol Abca12
Ensembl Gene ENSMUSG00000050296
Gene NameATP-binding cassette, sub-family A (ABC1), member 12
Synonyms4833417A11Rik, 4832428G11Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location71242276-71414910 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71319964 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 561 (D561A)
Ref Sequence ENSEMBL: ENSMUSP00000084523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087268]
Predicted Effect probably benign
Transcript: ENSMUST00000087268
AA Change: D561A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000084523
Gene: ENSMUSG00000050296
AA Change: D561A

DomainStartEndE-ValueType
transmembrane domain 24 43 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
Pfam:ABC2_membrane_3 885 1267 2.9e-24 PFAM
AAA 1370 1554 4.2e-10 SMART
low complexity region 1717 1735 N/A INTRINSIC
Pfam:ABC2_membrane_3 1744 2206 9.6e-35 PFAM
AAA 2282 2467 4.61e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily, which is the only major ABC subfamily found exclusively in multicellular eukaryotes. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with defective skin development and abnormal lung morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Abca12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abca12 APN 1 71303541 missense possibly damaging 0.64
IGL00556:Abca12 APN 1 71353757 missense probably benign 0.00
IGL00813:Abca12 APN 1 71353762 critical splice acceptor site probably null
IGL00835:Abca12 APN 1 71302733 missense probably damaging 1.00
IGL00921:Abca12 APN 1 71285729 missense probably damaging 1.00
IGL01011:Abca12 APN 1 71263632 missense probably benign 0.02
IGL01066:Abca12 APN 1 71353730 missense possibly damaging 0.95
IGL01082:Abca12 APN 1 71314114 missense probably damaging 1.00
IGL01310:Abca12 APN 1 71284156 missense probably benign 0.00
IGL01360:Abca12 APN 1 71286489 missense possibly damaging 0.95
IGL01585:Abca12 APN 1 71319886 missense probably benign 0.00
IGL01608:Abca12 APN 1 71259442 missense probably damaging 1.00
IGL01687:Abca12 APN 1 71267610 splice site probably benign
IGL01700:Abca12 APN 1 71280390 missense probably benign
IGL01723:Abca12 APN 1 71314168 missense probably benign 0.01
IGL01804:Abca12 APN 1 71276183 missense probably benign 0.01
IGL01982:Abca12 APN 1 71346698 missense probably benign 0.34
IGL02136:Abca12 APN 1 71247142 missense probably damaging 1.00
IGL02172:Abca12 APN 1 71302658 missense probably benign 0.09
IGL02222:Abca12 APN 1 71282886 missense probably benign 0.40
IGL02266:Abca12 APN 1 71268201 nonsense probably null
IGL02449:Abca12 APN 1 71401749 splice site probably null
IGL02471:Abca12 APN 1 71258198 missense probably benign 0.00
IGL02496:Abca12 APN 1 71288553 missense possibly damaging 0.55
IGL02552:Abca12 APN 1 71294747 missense probably damaging 0.96
IGL02795:Abca12 APN 1 71288748 missense probably damaging 1.00
IGL03000:Abca12 APN 1 71321800 missense probably benign 0.01
IGL03031:Abca12 APN 1 71314024 missense probably benign 0.00
IGL03131:Abca12 APN 1 71346702 missense probably benign
IGL03260:Abca12 APN 1 71284099 missense probably damaging 1.00
IGL03324:Abca12 APN 1 71314008 missense probably benign
IGL03408:Abca12 APN 1 71264795 missense probably damaging 1.00
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0016:Abca12 UTSW 1 71294800 missense probably benign 0.35
R0121:Abca12 UTSW 1 71259786 splice site probably null
R0172:Abca12 UTSW 1 71279402 missense probably damaging 0.99
R0196:Abca12 UTSW 1 71259813 missense possibly damaging 0.81
R0400:Abca12 UTSW 1 71259776 splice site probably benign
R0466:Abca12 UTSW 1 71302663 missense probably damaging 1.00
R0616:Abca12 UTSW 1 71302671 missense probably damaging 1.00
R0668:Abca12 UTSW 1 71263614 missense probably damaging 1.00
R0928:Abca12 UTSW 1 71349174 missense probably benign 0.06
R1036:Abca12 UTSW 1 71263410 critical splice donor site probably null
R1086:Abca12 UTSW 1 71295061 splice site probably benign
R1300:Abca12 UTSW 1 71244808 missense probably damaging 1.00
R1337:Abca12 UTSW 1 71294819 missense probably benign 0.03
R1356:Abca12 UTSW 1 71302953 splice site probably benign
R1372:Abca12 UTSW 1 71294857 missense probably damaging 1.00
R1434:Abca12 UTSW 1 71309800 missense probably benign 0.00
R1580:Abca12 UTSW 1 71265965 missense possibly damaging 0.65
R1675:Abca12 UTSW 1 71263411 critical splice donor site probably null
R1773:Abca12 UTSW 1 71288596 missense probably damaging 1.00
R1829:Abca12 UTSW 1 71295029 missense probably benign 0.26
R1922:Abca12 UTSW 1 71319924 missense probably benign 0.10
R1927:Abca12 UTSW 1 71244840 missense probably damaging 1.00
R2115:Abca12 UTSW 1 71244771 missense probably benign 0.01
R2146:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2148:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2149:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2150:Abca12 UTSW 1 71263488 missense probably benign 0.02
R2299:Abca12 UTSW 1 71258222 missense probably damaging 1.00
R2392:Abca12 UTSW 1 71258105 missense probably damaging 1.00
R2571:Abca12 UTSW 1 71249885 missense probably benign 0.00
R3077:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3078:Abca12 UTSW 1 71267605 missense probably benign 0.02
R3705:Abca12 UTSW 1 71285705 missense probably damaging 1.00
R3800:Abca12 UTSW 1 71265887 missense probably damaging 1.00
R3905:Abca12 UTSW 1 71268230 missense possibly damaging 0.79
R3905:Abca12 UTSW 1 71279457 missense probably benign 0.02
R3962:Abca12 UTSW 1 71274515 splice site probably null
R4082:Abca12 UTSW 1 71267463 missense possibly damaging 0.64
R4131:Abca12 UTSW 1 71319871 critical splice donor site probably null
R4214:Abca12 UTSW 1 71288697 missense probably damaging 0.99
R4403:Abca12 UTSW 1 71267436 missense probably damaging 1.00
R4524:Abca12 UTSW 1 71302917 missense probably benign 0.19
R4615:Abca12 UTSW 1 71330334 missense probably benign
R4617:Abca12 UTSW 1 71330334 missense probably benign
R4714:Abca12 UTSW 1 71321450 missense probably benign 0.00
R4809:Abca12 UTSW 1 71278856 missense probably benign 0.10
R4810:Abca12 UTSW 1 71303612 missense probably benign 0.00
R4825:Abca12 UTSW 1 71302685 missense possibly damaging 0.70
R4990:Abca12 UTSW 1 71294939 missense possibly damaging 0.61
R5013:Abca12 UTSW 1 71264767 missense probably damaging 0.99
R5026:Abca12 UTSW 1 71317224 missense probably benign 0.04
R5064:Abca12 UTSW 1 71300960 missense probably damaging 1.00
R5188:Abca12 UTSW 1 71291492 missense probably benign 0.23
R5234:Abca12 UTSW 1 71263664 missense probably damaging 0.99
R5267:Abca12 UTSW 1 71335774 splice site probably benign
R5302:Abca12 UTSW 1 71283952 missense possibly damaging 0.91
R5441:Abca12 UTSW 1 71295056 missense probably damaging 1.00
R5451:Abca12 UTSW 1 71294917 missense possibly damaging 0.94
R5526:Abca12 UTSW 1 71292446 missense probably benign 0.29
R5529:Abca12 UTSW 1 71264881 missense probably damaging 1.00
R5615:Abca12 UTSW 1 71307059 missense probably damaging 1.00
R5649:Abca12 UTSW 1 71291342 missense probably damaging 1.00
R5800:Abca12 UTSW 1 71321432 missense possibly damaging 0.78
R5807:Abca12 UTSW 1 71303492 missense probably damaging 1.00
R5878:Abca12 UTSW 1 71346633 missense possibly damaging 0.79
R5987:Abca12 UTSW 1 71258098 missense probably damaging 1.00
R6280:Abca12 UTSW 1 71272460 missense probably benign 0.04
R6316:Abca12 UTSW 1 71313959 missense probably benign 0.01
R6337:Abca12 UTSW 1 71295013 missense probably damaging 1.00
R6383:Abca12 UTSW 1 71247184 missense probably benign 0.03
R6564:Abca12 UTSW 1 71309850 missense possibly damaging 0.57
R6582:Abca12 UTSW 1 71258225 missense probably benign 0.00
R6756:Abca12 UTSW 1 71259353 splice site probably null
R6876:Abca12 UTSW 1 71263508 missense probably damaging 0.98
R6999:Abca12 UTSW 1 71317162 nonsense probably null
R7145:Abca12 UTSW 1 71307053 missense possibly damaging 0.92
R7272:Abca12 UTSW 1 71248432 missense probably damaging 0.99
R7285:Abca12 UTSW 1 71349155 nonsense probably null
R7421:Abca12 UTSW 1 71247136 nonsense probably null
R7531:Abca12 UTSW 1 71247173 missense probably damaging 0.99
R7592:Abca12 UTSW 1 71288677 missense probably benign 0.01
R7687:Abca12 UTSW 1 71258182 missense probably benign 0.00
R7690:Abca12 UTSW 1 71314154 missense probably benign 0.00
R7709:Abca12 UTSW 1 71335728 missense probably benign 0.00
R7754:Abca12 UTSW 1 71302887 missense probably benign
R7761:Abca12 UTSW 1 71330288 missense probably damaging 1.00
R7816:Abca12 UTSW 1 71292429 missense probably benign 0.01
R7821:Abca12 UTSW 1 71259791 missense probably benign 0.12
R7827:Abca12 UTSW 1 71414678 start gained probably benign
R7829:Abca12 UTSW 1 71292421 missense probably benign 0.37
R7863:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R7946:Abca12 UTSW 1 71293497 missense probably damaging 0.96
R8053:Abca12 UTSW 1 71349169 nonsense probably null
X0013:Abca12 UTSW 1 71248433 missense probably damaging 0.99
X0018:Abca12 UTSW 1 71314510 missense probably benign
X0063:Abca12 UTSW 1 71349064 missense probably benign 0.15
X0065:Abca12 UTSW 1 71341461 critical splice donor site probably null
Z1176:Abca12 UTSW 1 71284070 missense not run
Z1177:Abca12 UTSW 1 71276082 missense not run
Z1177:Abca12 UTSW 1 71282811 missense not run
Z1177:Abca12 UTSW 1 71292531 missense not run
Predicted Primers PCR Primer
(F):5'- CATGCAACTTCCTGGTGTCTTG -3'
(R):5'- GGCAGCATAAGTACAAGTCTAAATC -3'

Sequencing Primer
(F):5'- CTGGTGTCTTGCTGATAAATACC -3'
(R):5'- AGATCTTAAAGATGCAAAGCCTG -3'
Posted On2019-11-26