Mutagenetix > Incidental Mutation

Incidental Mutation 'R7736:Dmbt1'

596259

Institutional Source

Beutler Lab

Gene Symbol

Dmbt1

Ensembl Gene

ENSMUSG00000047517

Gene Name

deleted in malignant brain tumors 1

Synonyms

CRP-[a], Crpd, gp300, vomeroglandin, CRP-[b], ebnerin, MUCLIN, hensin

MMRRC Submission

045792-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.194) question?

Stock #

R7736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

131032053-131121630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 131116896 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 1782 (D1782V)

Ref Sequence

ENSEMBL: ENSMUSP00000146685 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084509] [ENSMUST00000124096] [ENSMUST00000208311] [ENSMUST00000213064]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084509
AA Change: D1771V

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000081556
Gene: ENSMUSG00000047517
AA Change: D1771V

Domain	Start	End	E-Value	Type
SR	37	137	5.54e-59	SMART
SR	186	286	3.6e-58	SMART
SR	324	424	1.21e-59	SMART
SR	463	563	2.97e-59	SMART
SR	602	702	3.36e-58	SMART
SR	741	841	5.17e-59	SMART
low complexity region	848	879	N/A	INTRINSIC
CUB	884	993	4.22e-41	SMART
CUB	1000	1109	7.35e-41	SMART
CUB	1126	1235	3.73e-42	SMART
CUB	1242	1351	2.02e-38	SMART
SR	1371	1471	3.92e-59	SMART
low complexity region	1476	1488	N/A	INTRINSIC
CUB	1494	1603	6.7e-44	SMART
ZP	1612	1860	8.11e-74	SMART
transmembrane domain	1906	1928	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124096

SMART Domains

Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

Domain	Start	End	E-Value	Type
Pfam:Pkinase	1	118	4.8e-19	PFAM
Pfam:Pkinase_Tyr	1	118	1.7e-50	PFAM
low complexity region	146	160	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000208311
AA Change: D1782V

Predicted Effect

probably benign
Transcript: ENSMUST00000209015

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213064
AA Change: D1608V

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Loss of sequences from human chromosome 10q has been associated with the progression of human cancers. This gene was originally isolated based on its deletion in a medulloblastoma cell line. This gene is expressed with transcripts of 6.0, 7.5, and 8.0 kb in fetal lung and with one transcript of 8.0 kb in adult lung, although the 7.5 kb transcript has not been characterized. The encoded protein precursor is a glycoprotein containing multiple scavenger receptor cysteine-rich (SRCR) domains separated by SRCR-interspersed domains (SID). Transcript variant 2 (8.0 kb) has been shown to bind surfactant protein D independently of carbohydrate recognition. This indicates that DMBT1 may not be a classical tumor suppressor gene, but rather play a role in the interaction of tumor cells and the immune system. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for one null allele display embryonic lethality and an abnormal inner cell mass. Mice homozygous for a different null allele are viable and fertile with an increased susceptibility to induced colitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	G	1: 71,319,964 (GRCm38)	D561A	probably benign	Het
Adgrg1	T	C	8: 95,005,337 (GRCm38)	F204S	probably benign	Het
Apoa2	T	C	1: 171,226,172 (GRCm38)	L72P	probably damaging	Het
Arhgef10	A	T	8: 14,980,583 (GRCm38)	K987*	probably null	Het
Arrb1	A	G	7: 99,539,774 (GRCm38)	D9G	unknown	Het
Asph	A	G	4: 9,621,930 (GRCm38)	S192P	possibly damaging	Het
Bcas1	G	A	2: 170,387,164 (GRCm38)	T309M	possibly damaging	Het
Bcat2	C	T	7: 45,585,193 (GRCm38)	T166M	possibly damaging	Het
Bmp5	A	T	9: 75,893,790 (GRCm38)	I401L	probably damaging	Het
Bpifb9b	G	A	2: 154,312,105 (GRCm38)	G261R	probably benign	Het
Cd53	T	A	3: 106,767,936 (GRCm38)	Y106F	probably benign	Het
Cdhr3	T	A	12: 33,053,520 (GRCm38)	D366V	probably benign	Het
Ceacam10	G	C	7: 24,781,211 (GRCm38)	V256L	unknown	Het
Cilp2	A	G	8: 69,881,421 (GRCm38)	Y976H	probably damaging	Het
Cklf	A	G	8: 104,261,555 (GRCm38)	T107A	possibly damaging	Het
Dhx16	T	A	17: 35,881,676 (GRCm38)	W167R	possibly damaging	Het
Dkk2	T	G	3: 132,178,014 (GRCm38)	L225R	probably damaging	Het
Ebag9	A	T	15: 44,628,404 (GRCm38)	D64V	probably damaging	Het
Eif3j2	T	C	18: 43,477,317 (GRCm38)	N144D	possibly damaging	Het
Foxk2	A	T	11: 121,299,647 (GRCm38)	Q538L	possibly damaging	Het
Fpgt	T	G	3: 155,087,110 (GRCm38)	I427L	probably benign	Het
Ganc	A	T	2: 120,433,814 (GRCm38)	N416I	possibly damaging	Het
Gata6	A	G	18: 11,084,379 (GRCm38)	Y556C	probably damaging	Het
Gga2	A	T	7: 121,990,524 (GRCm38)	V534E	probably damaging	Het
Gm6904	C	T	14: 59,251,145 (GRCm38)	D68N	probably benign	Het
Gm7324	T	A	14: 43,714,799 (GRCm38)	S300T	possibly damaging	Het
Gprc6a	A	C	10: 51,615,453 (GRCm38)	N733K	possibly damaging	Het
Hivep3	C	T	4: 120,095,543 (GRCm38)	T352I	possibly damaging	Het
Ift88	T	G	14: 57,445,664 (GRCm38)	V266G	probably benign	Het
Ikbkap	T	C	4: 56,776,920 (GRCm38)	T626A	possibly damaging	Het
Ip6k1	G	T	9: 108,045,692 (GRCm38)	G341V	probably damaging	Het
Itga3	G	T	11: 95,076,203 (GRCm38)	A45E	probably damaging	Het
Kctd14	T	A	7: 97,457,940 (GRCm38)	L134Q	probably damaging	Het
Lats1	C	A	10: 7,702,364 (GRCm38)	N417K	probably damaging	Het
Lrrc37a	T	C	11: 103,497,459 (GRCm38)	H2380R	unknown	Het
Lrrc4c	A	G	2: 97,630,360 (GRCm38)	T444A	probably benign	Het
M1ap	T	C	6: 83,005,584 (GRCm38)	I283T	probably benign	Het
Mapre2	T	C	18: 23,877,955 (GRCm38)	S207P	probably benign	Het
Moxd1	T	C	10: 24,282,710 (GRCm38)	F421L	probably damaging	Het
Nos2	T	A	11: 78,922,366 (GRCm38)	C33*	probably null	Het
Olfr115	A	T	17: 37,610,412 (GRCm38)	L113H	probably damaging	Het
Olfr154	T	C	2: 85,664,414 (GRCm38)	T7A	probably damaging	Het
Olfr345	A	T	2: 36,640,185 (GRCm38)	I49F	probably damaging	Het
Otud4	T	C	8: 79,655,765 (GRCm38)	I201T	possibly damaging	Het
Pank4	T	C	4: 154,969,747 (GRCm38)	Y128H	probably benign	Het
Pitpnm2	A	G	5: 124,123,030 (GRCm38)	V1027A	possibly damaging	Het
Plcb3	A	G	19: 6,969,623 (GRCm38)	V8A	probably benign	Het
Por	A	G	5: 135,731,122 (GRCm38)	E221G	probably damaging	Het
Prokr2	A	T	2: 132,381,580 (GRCm38)	L14*	probably null	Het
Ptgis	A	G	2: 167,191,971 (GRCm38)	F459S	unknown	Het
Ptpru	T	C	4: 131,788,382 (GRCm38)	E887G	probably damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541 (GRCm38)		probably benign	Het
Slc18a1	A	G	8: 69,065,554 (GRCm38)		probably null	Het
Slc27a3	A	G	3: 90,389,433 (GRCm38)	S120P	probably benign	Het
Slc2a12	T	A	10: 22,664,818 (GRCm38)	Y191N	probably damaging	Het
Snx29	T	A	16: 11,367,724 (GRCm38)	M57K	probably benign	Het
Syncrip	A	G	9: 88,461,668 (GRCm38)		probably null	Het
Taar4	T	A	10: 23,960,999 (GRCm38)	V169E	probably damaging	Het
Tas1r1	C	T	4: 152,032,466 (GRCm38)	G237D	probably benign	Het
Tle1	T	C	4: 72,199,334 (GRCm38)	K30E	probably damaging	Het
Tmem131l	A	T	3: 83,940,568 (GRCm38)	L330Q	probably damaging	Het
Tmem67	A	G	4: 12,053,455 (GRCm38)	F698L	probably benign	Het
Ttn	T	A	2: 76,909,230 (GRCm38)	Q3701L	unknown	Het
Vmn2r17	G	A	5: 109,452,891 (GRCm38)	R685K	probably benign	Het
Ylpm1	C	A	12: 85,012,983 (GRCm38)	A321E	unknown	Het
Zdbf2	T	A	1: 63,308,007 (GRCm38)	Y1848*	probably null	Het
Zfand2b	T	A	1: 75,169,532 (GRCm38)	N61K	probably null	Het
Zfp867	C	T	11: 59,463,190 (GRCm38)	A438T	probably damaging	Het
Zkscan14	G	A	5: 145,195,509 (GRCm38)	T404I	probably benign	Het
Zrsr1	C	T	11: 22,973,510 (GRCm38)	Q95*	probably null	Het

Other mutations in Dmbt1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Dmbt1	APN	7	131,079,540 (GRCm38)	intron	probably benign
IGL00161:Dmbt1	APN	7	131,109,628 (GRCm38)	missense	probably damaging	1.00
IGL00331:Dmbt1	APN	7	131,099,290 (GRCm38)	missense	possibly damaging	0.46
IGL00769:Dmbt1	APN	7	131,082,500 (GRCm38)	missense	probably damaging	0.99
IGL00792:Dmbt1	APN	7	131,097,607 (GRCm38)	missense	possibly damaging	0.66
IGL00823:Dmbt1	APN	7	131,058,158 (GRCm38)	missense	probably benign	0.26
IGL01072:Dmbt1	APN	7	131,085,368 (GRCm38)	splice site	probably benign
IGL01317:Dmbt1	APN	7	131,041,191 (GRCm38)	missense	probably damaging	1.00
IGL01335:Dmbt1	APN	7	131,088,767 (GRCm38)	missense	possibly damaging	0.95
IGL01372:Dmbt1	APN	7	131,103,679 (GRCm38)	missense	possibly damaging	0.90
IGL01511:Dmbt1	APN	7	131,116,728 (GRCm38)	missense	possibly damaging	0.49
IGL01627:Dmbt1	APN	7	131,081,185 (GRCm38)	missense	probably benign	0.14
IGL01890:Dmbt1	APN	7	131,074,419 (GRCm38)	intron	probably benign
IGL02160:Dmbt1	APN	7	131,082,688 (GRCm38)	missense	probably damaging	1.00
IGL02186:Dmbt1	APN	7	131,093,256 (GRCm38)	splice site	probably benign
IGL02197:Dmbt1	APN	7	131,085,422 (GRCm38)	splice site	probably benign
IGL02332:Dmbt1	APN	7	131,066,613 (GRCm38)	intron	probably benign
IGL02427:Dmbt1	APN	7	131,088,085 (GRCm38)	splice site	probably null
IGL02726:Dmbt1	APN	7	131,074,410 (GRCm38)	intron	probably benign
IGL02967:Dmbt1	APN	7	131,071,189 (GRCm38)	missense	possibly damaging	0.70
IGL03003:Dmbt1	APN	7	131,082,679 (GRCm38)	missense	probably benign	0.05
IGL03089:Dmbt1	APN	7	131,111,049 (GRCm38)	missense	probably damaging	0.99
cavity	UTSW	7	131,112,236 (GRCm38)	missense	unknown
lacunar	UTSW	7	131,097,631 (GRCm38)	missense	probably damaging	0.97
BB005:Dmbt1	UTSW	7	131,037,890 (GRCm38)	missense	probably benign	0.16
BB015:Dmbt1	UTSW	7	131,037,890 (GRCm38)	missense	probably benign	0.16
H8562:Dmbt1	UTSW	7	131,112,076 (GRCm38)	nonsense	probably null
K3955:Dmbt1	UTSW	7	131,119,564 (GRCm38)	missense	probably damaging	0.98
R0051:Dmbt1	UTSW	7	131,119,496 (GRCm38)	missense	possibly damaging	0.79
R0051:Dmbt1	UTSW	7	131,119,496 (GRCm38)	missense	possibly damaging	0.79
R0257:Dmbt1	UTSW	7	131,106,393 (GRCm38)	missense	probably damaging	1.00
R0388:Dmbt1	UTSW	7	131,096,049 (GRCm38)	splice site	probably benign
R0427:Dmbt1	UTSW	7	131,040,902 (GRCm38)	nonsense	probably null
R0478:Dmbt1	UTSW	7	131,041,187 (GRCm38)	missense	possibly damaging	0.93
R0502:Dmbt1	UTSW	7	131,097,673 (GRCm38)	splice site	probably null
R0538:Dmbt1	UTSW	7	131,049,901 (GRCm38)	splice site	probably benign
R0626:Dmbt1	UTSW	7	131,102,081 (GRCm38)	missense	probably damaging	0.97
R0631:Dmbt1	UTSW	7	131,097,653 (GRCm38)	missense	possibly damaging	0.90
R0948:Dmbt1	UTSW	7	131,093,117 (GRCm38)	missense	possibly damaging	0.95
R1169:Dmbt1	UTSW	7	131,074,524 (GRCm38)	critical splice donor site	probably null
R1413:Dmbt1	UTSW	7	131,050,214 (GRCm38)	missense	probably damaging	1.00
R1458:Dmbt1	UTSW	7	131,044,487 (GRCm38)	splice site	probably benign
R1463:Dmbt1	UTSW	7	131,109,637 (GRCm38)	critical splice donor site	probably null
R1509:Dmbt1	UTSW	7	131,074,331 (GRCm38)	intron	probably benign
R1990:Dmbt1	UTSW	7	131,058,288 (GRCm38)	missense	probably damaging	0.98
R2018:Dmbt1	UTSW	7	131,110,989 (GRCm38)	missense	possibly damaging	0.93
R2019:Dmbt1	UTSW	7	131,110,989 (GRCm38)	missense	possibly damaging	0.93
R2042:Dmbt1	UTSW	7	131,106,359 (GRCm38)	missense	probably damaging	0.99
R2056:Dmbt1	UTSW	7	131,106,170 (GRCm38)	missense	possibly damaging	0.80
R2057:Dmbt1	UTSW	7	131,106,170 (GRCm38)	missense	possibly damaging	0.80
R2058:Dmbt1	UTSW	7	131,106,170 (GRCm38)	missense	possibly damaging	0.80
R2059:Dmbt1	UTSW	7	131,106,170 (GRCm38)	missense	possibly damaging	0.80
R2061:Dmbt1	UTSW	7	131,099,133 (GRCm38)	missense	possibly damaging	0.66
R2092:Dmbt1	UTSW	7	131,050,018 (GRCm38)	missense	probably damaging	1.00
R2102:Dmbt1	UTSW	7	131,102,032 (GRCm38)	missense	probably damaging	0.97
R2155:Dmbt1	UTSW	7	131,097,575 (GRCm38)	missense	possibly damaging	0.66
R2243:Dmbt1	UTSW	7	131,046,562 (GRCm38)	missense	probably benign	0.03
R2256:Dmbt1	UTSW	7	131,090,494 (GRCm38)	missense	probably benign	0.01
R2391:Dmbt1	UTSW	7	131,106,468 (GRCm38)	missense	probably damaging	1.00
R2394:Dmbt1	UTSW	7	131,094,734 (GRCm38)	nonsense	probably null
R3014:Dmbt1	UTSW	7	131,032,097 (GRCm38)	intron	probably benign
R3155:Dmbt1	UTSW	7	131,050,157 (GRCm38)	nonsense	probably null
R3176:Dmbt1	UTSW	7	131,088,071 (GRCm38)	missense	probably benign	0.19
R3276:Dmbt1	UTSW	7	131,088,071 (GRCm38)	missense	probably benign	0.19
R3442:Dmbt1	UTSW	7	131,106,249 (GRCm38)	missense	probably damaging	1.00
R3807:Dmbt1	UTSW	7	131,112,090 (GRCm38)	missense	possibly damaging	0.77
R4060:Dmbt1	UTSW	7	131,074,202 (GRCm38)	intron	probably benign
R4396:Dmbt1	UTSW	7	131,116,632 (GRCm38)	missense	probably damaging	0.98
R4453:Dmbt1	UTSW	7	131,040,934 (GRCm38)	missense	probably damaging	1.00
R5001:Dmbt1	UTSW	7	131,050,012 (GRCm38)	missense	probably damaging	1.00
R5051:Dmbt1	UTSW	7	131,094,742 (GRCm38)	missense	probably benign	0.01
R5156:Dmbt1	UTSW	7	131,097,670 (GRCm38)	critical splice donor site	probably null
R5225:Dmbt1	UTSW	7	131,094,735 (GRCm38)	missense	possibly damaging	0.84
R5281:Dmbt1	UTSW	7	131,082,619 (GRCm38)	missense	probably damaging	1.00
R5308:Dmbt1	UTSW	7	131,041,021 (GRCm38)	missense	probably damaging	1.00
R5447:Dmbt1	UTSW	7	131,119,511 (GRCm38)	missense	probably damaging	0.99
R5467:Dmbt1	UTSW	7	131,040,993 (GRCm38)	missense	probably damaging	1.00
R5497:Dmbt1	UTSW	7	131,063,403 (GRCm38)	intron	probably benign
R5526:Dmbt1	UTSW	7	131,041,190 (GRCm38)	missense	probably damaging	1.00
R5554:Dmbt1	UTSW	7	131,099,300 (GRCm38)	nonsense	probably null
R5566:Dmbt1	UTSW	7	131,106,273 (GRCm38)	missense	probably damaging	1.00
R5595:Dmbt1	UTSW	7	131,054,067 (GRCm38)	missense	probably benign	0.17
R6154:Dmbt1	UTSW	7	131,109,641 (GRCm38)	splice site	probably null
R6188:Dmbt1	UTSW	7	131,097,631 (GRCm38)	missense	probably damaging	0.97
R6214:Dmbt1	UTSW	7	131,066,733 (GRCm38)	missense	possibly damaging	0.95
R6215:Dmbt1	UTSW	7	131,066,733 (GRCm38)	missense	possibly damaging	0.95
R6391:Dmbt1	UTSW	7	131,058,254 (GRCm38)	missense	probably damaging	1.00
R6397:Dmbt1	UTSW	7	131,103,578 (GRCm38)	missense	possibly damaging	0.46
R6436:Dmbt1	UTSW	7	131,116,641 (GRCm38)	missense	probably benign	0.01
R6603:Dmbt1	UTSW	7	131,046,510 (GRCm38)	splice site	probably null
R6719:Dmbt1	UTSW	7	131,119,603 (GRCm38)	missense	possibly damaging	0.83
R6781:Dmbt1	UTSW	7	131,046,561 (GRCm38)	missense	probably benign	0.16
R7148:Dmbt1	UTSW	7	131,066,734 (GRCm38)	nonsense	probably null
R7191:Dmbt1	UTSW	7	131,044,520 (GRCm38)	missense	unknown
R7269:Dmbt1	UTSW	7	131,066,621 (GRCm38)	missense	unknown
R7288:Dmbt1	UTSW	7	131,083,789 (GRCm38)	nonsense	probably null
R7296:Dmbt1	UTSW	7	131,112,132 (GRCm38)	missense	unknown
R7349:Dmbt1	UTSW	7	131,041,124 (GRCm38)	missense	unknown
R7386:Dmbt1	UTSW	7	131,112,236 (GRCm38)	missense	unknown
R7428:Dmbt1	UTSW	7	131,108,463 (GRCm38)	missense	possibly damaging	0.53
R7481:Dmbt1	UTSW	7	131,079,511 (GRCm38)	critical splice acceptor site	probably null
R7486:Dmbt1	UTSW	7	131,066,462 (GRCm38)	missense	unknown
R7513:Dmbt1	UTSW	7	131,090,512 (GRCm38)	missense	unknown
R7553:Dmbt1	UTSW	7	131,104,867 (GRCm38)	missense	unknown
R7567:Dmbt1	UTSW	7	131,061,363 (GRCm38)	splice site	probably null
R7584:Dmbt1	UTSW	7	131,088,751 (GRCm38)	nonsense	probably null
R7758:Dmbt1	UTSW	7	131,121,197 (GRCm38)	missense	unknown
R7928:Dmbt1	UTSW	7	131,037,890 (GRCm38)	missense	probably benign	0.16
R8080:Dmbt1	UTSW	7	131,088,770 (GRCm38)	missense	unknown
R8098:Dmbt1	UTSW	7	131,108,459 (GRCm38)	nonsense	probably null
R8125:Dmbt1	UTSW	7	131,099,223 (GRCm38)	missense	unknown
R8177:Dmbt1	UTSW	7	131,106,432 (GRCm38)	missense	possibly damaging	0.46
R8350:Dmbt1	UTSW	7	131,085,417 (GRCm38)	critical splice donor site	probably null
R8366:Dmbt1	UTSW	7	131,066,600 (GRCm38)	missense	unknown
R8378:Dmbt1	UTSW	7	131,106,465 (GRCm38)	missense	probably damaging	0.96
R8399:Dmbt1	UTSW	7	131,082,587 (GRCm38)	missense	unknown
R8400:Dmbt1	UTSW	7	131,082,587 (GRCm38)	missense	unknown
R8445:Dmbt1	UTSW	7	131,090,380 (GRCm38)	missense	unknown
R8450:Dmbt1	UTSW	7	131,085,417 (GRCm38)	critical splice donor site	probably null
R8511:Dmbt1	UTSW	7	131,102,012 (GRCm38)	missense	unknown
R8688:Dmbt1	UTSW	7	131,058,254 (GRCm38)	missense	unknown
R8850:Dmbt1	UTSW	7	131,090,404 (GRCm38)	missense	unknown
R8852:Dmbt1	UTSW	7	131,041,123 (GRCm38)	missense	unknown
R8871:Dmbt1	UTSW	7	131,116,868 (GRCm38)	missense	unknown
R8943:Dmbt1	UTSW	7	131,119,643 (GRCm38)	missense	possibly damaging	0.68
R8978:Dmbt1	UTSW	7	131,037,881 (GRCm38)	missense	possibly damaging	0.53
R9004:Dmbt1	UTSW	7	131,112,069 (GRCm38)	missense	unknown
R9020:Dmbt1	UTSW	7	131,111,058 (GRCm38)	missense	possibly damaging	0.86
R9088:Dmbt1	UTSW	7	131,116,689 (GRCm38)	missense	unknown
R9230:Dmbt1	UTSW	7	131,037,912 (GRCm38)	missense	probably benign	0.01
R9304:Dmbt1	UTSW	7	131,099,125 (GRCm38)	missense	unknown
R9377:Dmbt1	UTSW	7	131,093,102 (GRCm38)	missense	unknown
R9428:Dmbt1	UTSW	7	131,066,478 (GRCm38)	missense	unknown
R9474:Dmbt1	UTSW	7	131,074,257 (GRCm38)	missense	unknown
R9573:Dmbt1	UTSW	7	131,056,180 (GRCm38)	critical splice donor site	probably null
R9675:Dmbt1	UTSW	7	131,110,923 (GRCm38)	missense	probably damaging	0.98
R9689:Dmbt1	UTSW	7	131,058,285 (GRCm38)	missense	unknown
R9781:Dmbt1	UTSW	7	131,037,869 (GRCm38)	missense	probably benign	0.00
X0024:Dmbt1	UTSW	7	131,112,248 (GRCm38)	nonsense	probably null
X0062:Dmbt1	UTSW	7	131,094,851 (GRCm38)	missense	possibly damaging	0.81
Z1176:Dmbt1	UTSW	7	131,088,812 (GRCm38)	missense	unknown
Z1177:Dmbt1	UTSW	7	131,082,485 (GRCm38)	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGATGCTGCAGAACACCTGG -3'
(R):5'- AACCTGTGGGAAGTTCAGTTAGC -3'

Sequencing Primer
(F):5'- TGGGTCAACACCATGTACATC -3'
(R):5'- TGGGAAGTTCAGTTAGCCAAAAATC -3'

Posted On

2019-11-26