Incidental Mutation 'R7736:Arhgef10'
ID596260
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 14980583 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 987 (K987*)
Ref Sequence ENSEMBL: ENSMUSP00000081225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]
Predicted Effect probably null
Transcript: ENSMUST00000084207
AA Change: K987*
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: K987*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110800
AA Change: K948*
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: K948*

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000163062
AA Change: K630*
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: K630*

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R4685:Arhgef10 UTSW 8 14956963 missense probably damaging 1.00
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 14997547 nonsense probably null
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7544:Arhgef10 UTSW 8 14979854 missense probably benign 0.34
R7657:Arhgef10 UTSW 8 14979893 missense probably damaging 1.00
R7777:Arhgef10 UTSW 8 14945373 missense probably damaging 1.00
R8000:Arhgef10 UTSW 8 14930054 missense probably damaging 1.00
R8060:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R8441:Arhgef10 UTSW 8 14991237 splice site probably benign
R8545:Arhgef10 UTSW 8 14928868 missense probably benign 0.00
R8545:Arhgef10 UTSW 8 14975931 missense possibly damaging 0.83
R8702:Arhgef10 UTSW 8 14942638 missense probably benign
R8846:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R8854:Arhgef10 UTSW 8 14979798 critical splice acceptor site probably null
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAACTATGACCCAGACTCTCTC -3'
(R):5'- CATGGTGAGACTGACTTGCTGC -3'

Sequencing Primer
(F):5'- TATGACCCAGACTCTCTCTTCAAAC -3'
(R):5'- AGACTGACTTGCTGCCCAGG -3'
Posted On2019-11-26