Mutagenetix > Incidental Mutations

Incidental Mutation 'R7736:Arhgef10'

596260

Institutional Source

Beutler Lab

Gene Symbol

Arhgef10

Ensembl Gene

ENSMUSG00000071176

Gene Name

Rho guanine nucleotide exchange factor (GEF) 10

Synonyms

6430549H08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

14911663-15001085 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 14980583 bp

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 987 (K987*)

Ref Sequence

ENSEMBL: ENSMUSP00000081225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000163062]

Predicted Effect

probably null
Transcript: ENSMUST00000084207
AA Change: K987*

SMART Domains

Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: K987*

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
coiled coil region	308	335	N/A	INTRINSIC
RhoGEF	401	583	9.79e-58	SMART
Blast:PH	617	829	6e-47	BLAST
low complexity region	1256	1272	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110800
AA Change: K948*

SMART Domains

Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: K948*

Domain	Start	End	E-Value	Type
low complexity region	73	82	N/A	INTRINSIC
low complexity region	155	165	N/A	INTRINSIC
low complexity region	236	245	N/A	INTRINSIC
low complexity region	247	265	N/A	INTRINSIC
low complexity region	280	291	N/A	INTRINSIC
RhoGEF	362	544	9.79e-58	SMART
Blast:PH	578	790	8e-47	BLAST
low complexity region	1217	1233	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000163062
AA Change: K630*

SMART Domains

Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: K630*

Domain	Start	End	E-Value	Type
RhoGEF	73	255	9.79e-58	SMART
Blast:PH	289	501	2e-47	BLAST
low complexity region	899	915	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	G	1: 71,319,964	D561A	probably benign	Het
Adgrg1	T	C	8: 95,005,337	F204S	probably benign	Het
Apoa2	T	C	1: 171,226,172	L72P	probably damaging	Het
Arrb1	A	G	7: 99,539,774	D9G	unknown	Het
Asph	A	G	4: 9,621,930	S192P	possibly damaging	Het
Bcas1	G	A	2: 170,387,164	T309M	possibly damaging	Het
Bcat2	C	T	7: 45,585,193	T166M	possibly damaging	Het
Bmp5	A	T	9: 75,893,790	I401L	probably damaging	Het
Bpifb9b	G	A	2: 154,312,105	G261R	probably benign	Het
Cd53	T	A	3: 106,767,936	Y106F	probably benign	Het
Cdhr3	T	A	12: 33,053,520	D366V	probably benign	Het
Ceacam10	G	C	7: 24,781,211	V256L	unknown	Het
Cilp2	A	G	8: 69,881,421	Y976H	probably damaging	Het
Cklf	A	G	8: 104,261,555	T107A	possibly damaging	Het
Dhx16	T	A	17: 35,881,676	W167R	possibly damaging	Het
Dkk2	T	G	3: 132,178,014	L225R	probably damaging	Het
Dmbt1	A	T	7: 131,116,896	D1782V	unknown	Het
Ebag9	A	T	15: 44,628,404	D64V	probably damaging	Het
Eif3j2	T	C	18: 43,477,317	N144D	possibly damaging	Het
Foxk2	A	T	11: 121,299,647	Q538L	possibly damaging	Het
Fpgt	T	G	3: 155,087,110	I427L	probably benign	Het
Ganc	A	T	2: 120,433,814	N416I	possibly damaging	Het
Gata6	A	G	18: 11,084,379	Y556C	probably damaging	Het
Gga2	A	T	7: 121,990,524	V534E	probably damaging	Het
Gm6904	C	T	14: 59,251,145	D68N	probably benign	Het
Gm7324	T	A	14: 43,714,799	S300T	possibly damaging	Het
Gprc6a	A	C	10: 51,615,453	N733K	possibly damaging	Het
Hivep3	C	T	4: 120,095,543	T352I	possibly damaging	Het
Ift88	T	G	14: 57,445,664	V266G	probably benign	Het
Ikbkap	T	C	4: 56,776,920	T626A	possibly damaging	Het
Ip6k1	G	T	9: 108,045,692	G341V	probably damaging	Het
Itga3	G	T	11: 95,076,203	A45E	probably damaging	Het
Kctd14	T	A	7: 97,457,940	L134Q	probably damaging	Het
Lats1	C	A	10: 7,702,364	N417K	probably damaging	Het
Lrrc37a	T	C	11: 103,497,459	H2380R	unknown	Het
Lrrc4c	A	G	2: 97,630,360	T444A	probably benign	Het
M1ap	T	C	6: 83,005,584	I283T	probably benign	Het
Mapre2	T	C	18: 23,877,955	S207P	probably benign	Het
Moxd1	T	C	10: 24,282,710	F421L	probably damaging	Het
Nos2	T	A	11: 78,922,366	C33*	probably null	Het
Olfr115	A	T	17: 37,610,412	L113H	probably damaging	Het
Olfr154	T	C	2: 85,664,414	T7A	probably damaging	Het
Olfr345	A	T	2: 36,640,185	I49F	probably damaging	Het
Otud4	T	C	8: 79,655,765	I201T	possibly damaging	Het
Pank4	T	C	4: 154,969,747	Y128H	probably benign	Het
Pitpnm2	A	G	5: 124,123,030	V1027A	possibly damaging	Het
Plcb3	A	G	19: 6,969,623	V8A	probably benign	Het
Por	A	G	5: 135,731,122	E221G	probably damaging	Het
Prokr2	A	T	2: 132,381,580	L14*	probably null	Het
Ptgis	A	G	2: 167,191,971	F459S	unknown	Het
Ptpru	T	C	4: 131,788,382	E887G	probably damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Slc18a1	A	G	8: 69,065,554		probably null	Het
Slc27a3	A	G	3: 90,389,433	S120P	probably benign	Het
Slc2a12	T	A	10: 22,664,818	Y191N	probably damaging	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Syncrip	A	G	9: 88,461,668		probably null	Het
Taar4	T	A	10: 23,960,999	V169E	probably damaging	Het
Tas1r1	C	T	4: 152,032,466	G237D	probably benign	Het
Tle1	T	C	4: 72,199,334	K30E	probably damaging	Het
Tmem131l	A	T	3: 83,940,568	L330Q	probably damaging	Het
Tmem67	A	G	4: 12,053,455	F698L	probably benign	Het
Ttn	T	A	2: 76,909,230	Q3701L	unknown	Het
Vmn2r17	G	A	5: 109,452,891	R685K	probably benign	Het
Ylpm1	C	A	12: 85,012,983	A321E	unknown	Het
Zdbf2	T	A	1: 63,308,007	Y1848*	probably null	Het
Zfand2b	T	A	1: 75,169,532	N61K	probably null	Het
Zfp867	C	T	11: 59,463,190	A438T	probably damaging	Het
Zkscan14	G	A	5: 145,195,509	T404I	probably benign	Het
Zrsr1	C	T	11: 22,973,510	Q95*	probably null	Het

Other mutations in Arhgef10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00766:Arhgef10	APN	8	14975006	missense	probably damaging	1.00
IGL00823:Arhgef10	APN	8	14940378	unclassified	probably benign
IGL01012:Arhgef10	APN	8	14979977	missense	probably damaging	0.99
IGL01311:Arhgef10	APN	8	14991054	splice site	probably null
IGL01596:Arhgef10	APN	8	14999468	nonsense	probably null
IGL01888:Arhgef10	APN	8	14962577	nonsense	probably null
IGL01938:Arhgef10	APN	8	14991062	missense	probably benign	0.09
IGL02151:Arhgef10	APN	8	14928889	missense	possibly damaging	0.77
IGL02274:Arhgef10	APN	8	14947205	missense	probably damaging	0.99
IGL02369:Arhgef10	APN	8	14997551	missense	probably damaging	1.00
IGL02411:Arhgef10	APN	8	14954819	missense	probably benign	0.01
IGL02500:Arhgef10	APN	8	14961238	missense	probably damaging	1.00
IGL02597:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02602:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02743:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL02744:Arhgef10	APN	8	14930198	missense	probably benign	0.27
IGL03113:Arhgef10	APN	8	14954505	missense	probably damaging	1.00
IGL03248:Arhgef10	APN	8	14928847	missense	probably benign	0.00
P0028:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
P4748:Arhgef10	UTSW	8	14928925	missense	possibly damaging	0.79
R0049:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R0197:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0479:Arhgef10	UTSW	8	14991070	missense	probably damaging	0.98
R0701:Arhgef10	UTSW	8	14962636	missense	probably damaging	1.00
R0966:Arhgef10	UTSW	8	14940343	missense	probably benign	0.01
R1367:Arhgef10	UTSW	8	14940225	missense	probably damaging	1.00
R1572:Arhgef10	UTSW	8	14991211	missense	possibly damaging	0.53
R1631:Arhgef10	UTSW	8	14947157	missense	probably damaging	0.98
R1766:Arhgef10	UTSW	8	14979836	missense	probably damaging	1.00
R1920:Arhgef10	UTSW	8	14956987	splice site	probably benign
R2051:Arhgef10	UTSW	8	14945320	missense	probably null	1.00
R2088:Arhgef10	UTSW	8	14983898	missense	possibly damaging	0.46
R2118:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2120:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2121:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2122:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2124:Arhgef10	UTSW	8	14934820	missense	probably damaging	0.99
R2318:Arhgef10	UTSW	8	14928855	missense	probably damaging	1.00
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2870:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2870:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2872:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2872:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R2874:Arhgef10	UTSW	8	14975093	critical splice donor site	probably null
R2874:Arhgef10	UTSW	8	14975666	missense	probably benign	0.01
R3522:Arhgef10	UTSW	8	14954918	missense	probably damaging	1.00
R4049:Arhgef10	UTSW	8	14979998	missense	probably benign	0.05
R4324:Arhgef10	UTSW	8	14940335	missense	possibly damaging	0.77
R4351:Arhgef10	UTSW	8	14991145	nonsense	probably null
R4384:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4385:Arhgef10	UTSW	8	14930157	nonsense	probably null
R4685:Arhgef10	UTSW	8	14956963	missense	probably damaging	1.00
R5111:Arhgef10	UTSW	8	14932408	missense	probably benign	0.00
R5169:Arhgef10	UTSW	8	14930051	missense	possibly damaging	0.80
R5670:Arhgef10	UTSW	8	14954774	missense	probably benign	0.01
R5945:Arhgef10	UTSW	8	14980028	critical splice donor site	probably null
R6593:Arhgef10	UTSW	8	14962522	missense	probably damaging	1.00
R6593:Arhgef10	UTSW	8	14962564	missense	possibly damaging	0.82
R6734:Arhgef10	UTSW	8	14975053	missense	probably damaging	1.00
R6859:Arhgef10	UTSW	8	14975005	missense	probably damaging	1.00
R6890:Arhgef10	UTSW	8	14928786	missense	probably benign	0.27
R7068:Arhgef10	UTSW	8	14958639	missense	probably damaging	1.00
R7081:Arhgef10	UTSW	8	14997547	nonsense	probably null
R7157:Arhgef10	UTSW	8	14930030	missense	probably damaging	1.00
R7232:Arhgef10	UTSW	8	14940323	missense	probably benign	0.10
R7514:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R7544:Arhgef10	UTSW	8	14979854	missense	probably benign	0.34
R7657:Arhgef10	UTSW	8	14979893	missense	probably damaging	1.00
R7777:Arhgef10	UTSW	8	14945373	missense	probably damaging	1.00
R8000:Arhgef10	UTSW	8	14930054	missense	probably damaging	1.00
R8060:Arhgef10	UTSW	8	14954446	missense	probably damaging	1.00
R8441:Arhgef10	UTSW	8	14991237	splice site	probably benign
R8545:Arhgef10	UTSW	8	14928868	missense	probably benign	0.00
R8545:Arhgef10	UTSW	8	14975931	missense	possibly damaging	0.83
R8702:Arhgef10	UTSW	8	14942638	missense	probably benign
R8846:Arhgef10	UTSW	8	14975956	missense	probably benign	0.16
R8854:Arhgef10	UTSW	8	14979798	critical splice acceptor site	probably null
X0024:Arhgef10	UTSW	8	14978486	missense	probably benign	0.01
X0027:Arhgef10	UTSW	8	14997631	missense	possibly damaging	0.92
Z1088:Arhgef10	UTSW	8	14964191	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GAACTATGACCCAGACTCTCTC -3'
(R):5'- CATGGTGAGACTGACTTGCTGC -3'

Sequencing Primer
(F):5'- TATGACCCAGACTCTCTCTTCAAAC -3'
(R):5'- AGACTGACTTGCTGCCCAGG -3'

Posted On

2019-11-26