Incidental Mutation 'R7736:Slc18a1'
ID596261
Institutional Source Beutler Lab
Gene Symbol Slc18a1
Ensembl Gene ENSMUSG00000036330
Gene Namesolute carrier family 18 (vesicular monoamine), member 1
Synonyms4832416I10Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location69037711-69089235 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 69065554 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037478] [ENSMUST00000037478]
Predicted Effect probably null
Transcript: ENSMUST00000037478
SMART Domains Protein: ENSMUSP00000046924
Gene: ENSMUSG00000036330

DomainStartEndE-ValueType
Pfam:MFS_1 24 430 3.7e-34 PFAM
Pfam:MFS_1 302 508 9e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000037478
SMART Domains Protein: ENSMUSP00000046924
Gene: ENSMUSG00000036330

DomainStartEndE-ValueType
Pfam:MFS_1 24 430 3.7e-34 PFAM
Pfam:MFS_1 302 508 9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The vesicular monoamine transporter acts to accumulate cytosolic monoamines into vesicles, using the proton gradient maintained across the vesicular membrane. Its proper function is essential to the correct activity of the monoaminergic systems that have been implicated in several human neuropsychiatric disorders. The transporter is a site of action of important drugs, including reserpine and tetrabenazine (Peter et al., 1993 [PubMed 7905859]). See also SLC18A2 (MIM 193001).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased neuron apoptosis, decreased neuron proliferation and impaired spatial object recognition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Slc18a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Slc18a1 APN 8 69051346 missense probably damaging 1.00
IGL00661:Slc18a1 APN 8 69073731 missense probably benign 0.00
IGL01568:Slc18a1 APN 8 69065626 missense probably damaging 1.00
IGL02199:Slc18a1 APN 8 69043980 missense probably benign 0.03
IGL03011:Slc18a1 APN 8 69038863 missense probably benign
IGL03260:Slc18a1 APN 8 69075114 missense probably benign 0.24
R0349:Slc18a1 UTSW 8 69072101 missense probably damaging 1.00
R1019:Slc18a1 UTSW 8 69075033 critical splice donor site probably null
R1759:Slc18a1 UTSW 8 69065585 missense possibly damaging 0.95
R1928:Slc18a1 UTSW 8 69073812 missense probably benign 0.00
R2058:Slc18a1 UTSW 8 69043961 missense probably damaging 1.00
R4652:Slc18a1 UTSW 8 69043931 missense possibly damaging 0.71
R4724:Slc18a1 UTSW 8 69073649 nonsense probably null
R4818:Slc18a1 UTSW 8 69040299 missense probably damaging 0.99
R6799:Slc18a1 UTSW 8 69040981 missense probably benign 0.05
R6989:Slc18a1 UTSW 8 69038862 missense probably benign 0.01
R7557:Slc18a1 UTSW 8 69065561 missense probably damaging 1.00
R8024:Slc18a1 UTSW 8 69075147 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCCATAGGATGCAAAACTGG -3'
(R):5'- CTTAGTCCCCAAAGCCTTCAG -3'

Sequencing Primer
(F):5'- GAGAACAGTTCTGTTTATTCACTGG -3'
(R):5'- CTTCAGAAAAGGCTCAGCAGGTG -3'
Posted On2019-11-26