Mutagenetix > Incidental Mutation

Incidental Mutation 'R7736:Lats1'

596269

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

045792-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.890) question?

Stock #

R7736 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 7702364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 417 (N417K)

Ref Sequence

ENSEMBL: ENSMUSP00000132078 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: N417K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: N417K

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: N417K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: N417K

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: N417K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca12	T	G	1: 71,319,964	D561A	probably benign	Het
Adgrg1	T	C	8: 95,005,337	F204S	probably benign	Het
Apoa2	T	C	1: 171,226,172	L72P	probably damaging	Het
Arhgef10	A	T	8: 14,980,583	K987*	probably null	Het
Arrb1	A	G	7: 99,539,774	D9G	unknown	Het
Asph	A	G	4: 9,621,930	S192P	possibly damaging	Het
Bcas1	G	A	2: 170,387,164	T309M	possibly damaging	Het
Bcat2	C	T	7: 45,585,193	T166M	possibly damaging	Het
Bmp5	A	T	9: 75,893,790	I401L	probably damaging	Het
Bpifb9b	G	A	2: 154,312,105	G261R	probably benign	Het
Cd53	T	A	3: 106,767,936	Y106F	probably benign	Het
Cdhr3	T	A	12: 33,053,520	D366V	probably benign	Het
Ceacam10	G	C	7: 24,781,211	V256L	unknown	Het
Cilp2	A	G	8: 69,881,421	Y976H	probably damaging	Het
Cklf	A	G	8: 104,261,555	T107A	possibly damaging	Het
Dhx16	T	A	17: 35,881,676	W167R	possibly damaging	Het
Dkk2	T	G	3: 132,178,014	L225R	probably damaging	Het
Dmbt1	A	T	7: 131,116,896	D1782V	unknown	Het
Ebag9	A	T	15: 44,628,404	D64V	probably damaging	Het
Eif3j2	T	C	18: 43,477,317	N144D	possibly damaging	Het
Foxk2	A	T	11: 121,299,647	Q538L	possibly damaging	Het
Fpgt	T	G	3: 155,087,110	I427L	probably benign	Het
Ganc	A	T	2: 120,433,814	N416I	possibly damaging	Het
Gata6	A	G	18: 11,084,379	Y556C	probably damaging	Het
Gga2	A	T	7: 121,990,524	V534E	probably damaging	Het
Gm6904	C	T	14: 59,251,145	D68N	probably benign	Het
Gm7324	T	A	14: 43,714,799	S300T	possibly damaging	Het
Gprc6a	A	C	10: 51,615,453	N733K	possibly damaging	Het
Hivep3	C	T	4: 120,095,543	T352I	possibly damaging	Het
Ift88	T	G	14: 57,445,664	V266G	probably benign	Het
Ikbkap	T	C	4: 56,776,920	T626A	possibly damaging	Het
Ip6k1	G	T	9: 108,045,692	G341V	probably damaging	Het
Itga3	G	T	11: 95,076,203	A45E	probably damaging	Het
Kctd14	T	A	7: 97,457,940	L134Q	probably damaging	Het
Lrrc37a	T	C	11: 103,497,459	H2380R	unknown	Het
Lrrc4c	A	G	2: 97,630,360	T444A	probably benign	Het
M1ap	T	C	6: 83,005,584	I283T	probably benign	Het
Mapre2	T	C	18: 23,877,955	S207P	probably benign	Het
Moxd1	T	C	10: 24,282,710	F421L	probably damaging	Het
Nos2	T	A	11: 78,922,366	C33*	probably null	Het
Olfr115	A	T	17: 37,610,412	L113H	probably damaging	Het
Olfr154	T	C	2: 85,664,414	T7A	probably damaging	Het
Olfr345	A	T	2: 36,640,185	I49F	probably damaging	Het
Otud4	T	C	8: 79,655,765	I201T	possibly damaging	Het
Pank4	T	C	4: 154,969,747	Y128H	probably benign	Het
Pitpnm2	A	G	5: 124,123,030	V1027A	possibly damaging	Het
Plcb3	A	G	19: 6,969,623	V8A	probably benign	Het
Por	A	G	5: 135,731,122	E221G	probably damaging	Het
Prokr2	A	T	2: 132,381,580	L14*	probably null	Het
Ptgis	A	G	2: 167,191,971	F459S	unknown	Het
Ptpru	T	C	4: 131,788,382	E887G	probably damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Slc18a1	A	G	8: 69,065,554		probably null	Het
Slc27a3	A	G	3: 90,389,433	S120P	probably benign	Het
Slc2a12	T	A	10: 22,664,818	Y191N	probably damaging	Het
Snx29	T	A	16: 11,367,724	M57K	probably benign	Het
Syncrip	A	G	9: 88,461,668		probably null	Het
Taar4	T	A	10: 23,960,999	V169E	probably damaging	Het
Tas1r1	C	T	4: 152,032,466	G237D	probably benign	Het
Tle1	T	C	4: 72,199,334	K30E	probably damaging	Het
Tmem131l	A	T	3: 83,940,568	L330Q	probably damaging	Het
Tmem67	A	G	4: 12,053,455	F698L	probably benign	Het
Ttn	T	A	2: 76,909,230	Q3701L	unknown	Het
Vmn2r17	G	A	5: 109,452,891	R685K	probably benign	Het
Ylpm1	C	A	12: 85,012,983	A321E	unknown	Het
Zdbf2	T	A	1: 63,308,007	Y1848*	probably null	Het
Zfand2b	T	A	1: 75,169,532	N61K	probably null	Het
Zfp867	C	T	11: 59,463,190	A438T	probably damaging	Het
Zkscan14	G	A	5: 145,195,509	T404I	probably benign	Het
Zrsr1	C	T	11: 22,973,510	Q95*	probably null	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4663:Lats1	UTSW	10	7712583	missense	probably damaging	1.00
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTCAGTCTGATTTTATCGTGCAC -3'
(R):5'- ACTGTAGTGGCAGAAGGCTG -3'

Sequencing Primer
(F):5'- TTATCGTGCACCAAAATGTCC -3'
(R):5'- CTGAGAATTAGCAGAGTGACTTGCTC -3'

Posted On

2019-11-26