Incidental Mutation 'R7736:Gprc6a'
ID 596273
Institutional Source Beutler Lab
Gene Symbol Gprc6a
Ensembl Gene ENSMUSG00000019905
Gene Name G protein-coupled receptor, family C, group 6, member A
Synonyms
MMRRC Submission 045792-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7736 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 51490919-51507554 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 51491549 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 733 (N733K)
Ref Sequence ENSEMBL: ENSMUSP00000020062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020062] [ENSMUST00000218684] [ENSMUST00000219286]
AlphaFold Q8K4Z6
Predicted Effect possibly damaging
Transcript: ENSMUST00000020062
AA Change: N733K

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020062
Gene: ENSMUSG00000019905
AA Change: N733K

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 73 482 2.3e-62 PFAM
Pfam:NCD3G 519 572 5.9e-18 PFAM
Pfam:7tm_3 600 838 2e-49 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000218684
AA Change: N558K

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219286
AA Change: N662K

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of family C of the G protein-coupled receptor (GPCR) superfamily, such as GPRC6A, are characterized by an evolutionarily conserved amino acid-sensing motif linked to an intramembranous 7-transmembrane loop region. Several members of GPCR family C, including GPRC6A, also have a long N-terminal domain (summary by Pi et al., 2005 [PubMed 16199532]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a knock-out allele show a metabolic syndrome characterized by impaired bone mineralization, increased fat mass, abnormal renal handling of calcium and phosphorus, fatty liver, glucose intolerance, testicular feminization and abnormal steroidogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,359,123 (GRCm39) D561A probably benign Het
Adgrg1 T C 8: 95,731,965 (GRCm39) F204S probably benign Het
Apoa2 T C 1: 171,053,741 (GRCm39) L72P probably damaging Het
Arhgef10 A T 8: 15,030,583 (GRCm39) K987* probably null Het
Arrb1 A G 7: 99,188,981 (GRCm39) D9G unknown Het
Asph A G 4: 9,621,930 (GRCm39) S192P possibly damaging Het
Bcas1 G A 2: 170,229,084 (GRCm39) T309M possibly damaging Het
Bcat2 C T 7: 45,234,617 (GRCm39) T166M possibly damaging Het
Bmp5 A T 9: 75,801,072 (GRCm39) I401L probably damaging Het
Bpifb9b G A 2: 154,154,025 (GRCm39) G261R probably benign Het
Cd53 T A 3: 106,675,252 (GRCm39) Y106F probably benign Het
Cdhr3 T A 12: 33,103,519 (GRCm39) D366V probably benign Het
Ceacam10 G C 7: 24,480,636 (GRCm39) V256L unknown Het
Cilp2 A G 8: 70,334,071 (GRCm39) Y976H probably damaging Het
Cklf A G 8: 104,988,187 (GRCm39) T107A possibly damaging Het
Dhx16 T A 17: 36,192,568 (GRCm39) W167R possibly damaging Het
Dkk2 T G 3: 131,883,775 (GRCm39) L225R probably damaging Het
Dmbt1 A T 7: 130,718,625 (GRCm39) D1782V unknown Het
Ebag9 A T 15: 44,491,800 (GRCm39) D64V probably damaging Het
Eif3j2 T C 18: 43,610,382 (GRCm39) N144D possibly damaging Het
Elp1 T C 4: 56,776,920 (GRCm39) T626A possibly damaging Het
Foxk2 A T 11: 121,190,473 (GRCm39) Q538L possibly damaging Het
Fpgt T G 3: 154,792,747 (GRCm39) I427L probably benign Het
Ganc A T 2: 120,264,295 (GRCm39) N416I possibly damaging Het
Gata6 A G 18: 11,084,379 (GRCm39) Y556C probably damaging Het
Gga2 A T 7: 121,589,747 (GRCm39) V534E probably damaging Het
Gm7324 T A 14: 43,952,256 (GRCm39) S300T possibly damaging Het
Hivep3 C T 4: 119,952,740 (GRCm39) T352I possibly damaging Het
Ift88 T G 14: 57,683,121 (GRCm39) V266G probably benign Het
Ip6k1 G T 9: 107,922,891 (GRCm39) G341V probably damaging Het
Itga3 G T 11: 94,967,029 (GRCm39) A45E probably damaging Het
Kctd14 T A 7: 97,107,147 (GRCm39) L134Q probably damaging Het
Lats1 C A 10: 7,578,128 (GRCm39) N417K probably damaging Het
Lrrc37a T C 11: 103,388,285 (GRCm39) H2380R unknown Het
Lrrc4c A G 2: 97,460,705 (GRCm39) T444A probably benign Het
M1ap T C 6: 82,982,565 (GRCm39) I283T probably benign Het
Mapre2 T C 18: 24,011,012 (GRCm39) S207P probably benign Het
Moxd1 T C 10: 24,158,608 (GRCm39) F421L probably damaging Het
Nos2 T A 11: 78,813,192 (GRCm39) C33* probably null Het
Or14j4 A T 17: 37,921,303 (GRCm39) L113H probably damaging Het
Or1j16 A T 2: 36,530,197 (GRCm39) I49F probably damaging Het
Or5g26 T C 2: 85,494,758 (GRCm39) T7A probably damaging Het
Otud4 T C 8: 80,382,394 (GRCm39) I201T possibly damaging Het
Pank4 T C 4: 155,054,204 (GRCm39) Y128H probably benign Het
Phf11 C T 14: 59,488,594 (GRCm39) D68N probably benign Het
Pitpnm2 A G 5: 124,261,093 (GRCm39) V1027A possibly damaging Het
Plcb3 A G 19: 6,946,991 (GRCm39) V8A probably benign Het
Por A G 5: 135,759,976 (GRCm39) E221G probably damaging Het
Prokr2 A T 2: 132,223,500 (GRCm39) L14* probably null Het
Ptgis A G 2: 167,033,891 (GRCm39) F459S unknown Het
Ptpru T C 4: 131,515,693 (GRCm39) E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Slc18a1 A G 8: 69,518,206 (GRCm39) probably null Het
Slc27a3 A G 3: 90,296,740 (GRCm39) S120P probably benign Het
Slc2a12 T A 10: 22,540,717 (GRCm39) Y191N probably damaging Het
Snx29 T A 16: 11,185,588 (GRCm39) M57K probably benign Het
Syncrip A G 9: 88,343,721 (GRCm39) probably null Het
Taar4 T A 10: 23,836,897 (GRCm39) V169E probably damaging Het
Tas1r1 C T 4: 152,116,923 (GRCm39) G237D probably benign Het
Tle1 T C 4: 72,117,571 (GRCm39) K30E probably damaging Het
Tmem131l A T 3: 83,847,875 (GRCm39) L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 (GRCm39) F698L probably benign Het
Ttn T A 2: 76,739,574 (GRCm39) Q3701L unknown Het
Vmn2r17 G A 5: 109,600,757 (GRCm39) R685K probably benign Het
Ylpm1 C A 12: 85,059,757 (GRCm39) A321E unknown Het
Zdbf2 T A 1: 63,347,166 (GRCm39) Y1848* probably null Het
Zfand2b T A 1: 75,146,176 (GRCm39) N61K probably null Het
Zfp867 C T 11: 59,354,016 (GRCm39) A438T probably damaging Het
Zkscan14 G A 5: 145,132,319 (GRCm39) T404I probably benign Het
Zrsr2-ps1 C T 11: 22,923,510 (GRCm39) Q95* probably null Het
Other mutations in Gprc6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Gprc6a APN 10 51,491,526 (GRCm39) missense probably damaging 1.00
IGL01640:Gprc6a APN 10 51,503,180 (GRCm39) missense probably damaging 0.99
IGL02122:Gprc6a APN 10 51,502,819 (GRCm39) missense probably benign
IGL02317:Gprc6a APN 10 51,497,049 (GRCm39) missense probably benign 0.01
IGL02995:Gprc6a APN 10 51,502,895 (GRCm39) missense probably damaging 1.00
IGL03229:Gprc6a APN 10 51,492,699 (GRCm39) missense probably damaging 1.00
IGL03256:Gprc6a APN 10 51,504,445 (GRCm39) missense possibly damaging 0.77
IGL03290:Gprc6a APN 10 51,491,968 (GRCm39) missense probably damaging 1.00
IGL03393:Gprc6a APN 10 51,491,355 (GRCm39) missense probably damaging 1.00
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0040:Gprc6a UTSW 10 51,491,080 (GRCm39) nonsense probably null
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R0050:Gprc6a UTSW 10 51,491,485 (GRCm39) missense probably damaging 1.00
R1495:Gprc6a UTSW 10 51,504,533 (GRCm39) missense probably benign 0.01
R1831:Gprc6a UTSW 10 51,491,902 (GRCm39) missense probably benign 0.22
R2108:Gprc6a UTSW 10 51,491,304 (GRCm39) missense probably damaging 1.00
R2159:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2160:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2162:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R2229:Gprc6a UTSW 10 51,502,891 (GRCm39) missense possibly damaging 0.50
R3009:Gprc6a UTSW 10 51,504,392 (GRCm39) missense probably benign 0.02
R3709:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3710:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3737:Gprc6a UTSW 10 51,503,007 (GRCm39) missense probably benign
R3914:Gprc6a UTSW 10 51,504,371 (GRCm39) missense probably benign 0.00
R3918:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3964:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3965:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3966:Gprc6a UTSW 10 51,491,776 (GRCm39) frame shift probably null
R3973:Gprc6a UTSW 10 51,504,544 (GRCm39) missense possibly damaging 0.93
R3977:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3978:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R3979:Gprc6a UTSW 10 51,497,197 (GRCm39) missense probably benign 0.18
R4306:Gprc6a UTSW 10 51,492,735 (GRCm39) missense probably damaging 1.00
R4404:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4405:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4408:Gprc6a UTSW 10 51,504,639 (GRCm39) missense probably benign 0.09
R4713:Gprc6a UTSW 10 51,507,553 (GRCm39) unclassified probably benign
R4788:Gprc6a UTSW 10 51,491,104 (GRCm39) missense probably benign 0.00
R5248:Gprc6a UTSW 10 51,491,089 (GRCm39) missense probably damaging 1.00
R5263:Gprc6a UTSW 10 51,502,900 (GRCm39) missense probably damaging 1.00
R5436:Gprc6a UTSW 10 51,502,798 (GRCm39) missense probably benign
R5721:Gprc6a UTSW 10 51,491,076 (GRCm39) missense probably benign 0.06
R6061:Gprc6a UTSW 10 51,491,907 (GRCm39) missense probably damaging 1.00
R6092:Gprc6a UTSW 10 51,491,173 (GRCm39) missense probably damaging 1.00
R6132:Gprc6a UTSW 10 51,491,356 (GRCm39) missense possibly damaging 0.89
R6162:Gprc6a UTSW 10 51,491,008 (GRCm39) missense probably benign 0.44
R6207:Gprc6a UTSW 10 51,502,931 (GRCm39) missense probably benign 0.36
R6497:Gprc6a UTSW 10 51,491,797 (GRCm39) missense probably benign 0.05
R6717:Gprc6a UTSW 10 51,491,233 (GRCm39) missense probably damaging 1.00
R6789:Gprc6a UTSW 10 51,507,412 (GRCm39) missense probably damaging 1.00
R6807:Gprc6a UTSW 10 51,502,841 (GRCm39) nonsense probably null
R7000:Gprc6a UTSW 10 51,491,143 (GRCm39) missense probably benign 0.34
R7019:Gprc6a UTSW 10 51,507,508 (GRCm39) missense possibly damaging 0.68
R7143:Gprc6a UTSW 10 51,490,986 (GRCm39) missense probably benign
R7173:Gprc6a UTSW 10 51,504,595 (GRCm39) missense probably benign 0.01
R7579:Gprc6a UTSW 10 51,502,883 (GRCm39) missense probably benign
R7920:Gprc6a UTSW 10 51,491,026 (GRCm39) missense probably benign 0.02
R8273:Gprc6a UTSW 10 51,507,370 (GRCm39) missense probably benign
R8329:Gprc6a UTSW 10 51,503,355 (GRCm39) nonsense probably null
R8517:Gprc6a UTSW 10 51,507,337 (GRCm39) missense probably benign 0.00
R8723:Gprc6a UTSW 10 51,491,518 (GRCm39) missense probably damaging 1.00
R8815:Gprc6a UTSW 10 51,497,079 (GRCm39) missense probably benign 0.00
R8829:Gprc6a UTSW 10 51,491,295 (GRCm39) missense probably damaging 0.99
R9151:Gprc6a UTSW 10 51,497,182 (GRCm39) missense possibly damaging 0.94
R9420:Gprc6a UTSW 10 51,491,506 (GRCm39) missense probably damaging 0.99
R9753:Gprc6a UTSW 10 51,504,364 (GRCm39) missense probably benign 0.20
R9766:Gprc6a UTSW 10 51,491,884 (GRCm39) missense probably damaging 1.00
R9790:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
R9791:Gprc6a UTSW 10 51,491,395 (GRCm39) missense probably damaging 0.98
Z1177:Gprc6a UTSW 10 51,491,305 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATCCCAAAGGTCAGGAACTTG -3'
(R):5'- ACTTTGCGTGCAAGACCAGG -3'

Sequencing Primer
(F):5'- CCAAAGGTCAGGAACTTGGCTTC -3'
(R):5'- GTGTCTCCTGTATTTTGACCAAG -3'
Posted On 2019-11-26