Incidental Mutation 'R7736:Lrrc37a'
ID596278
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103497459 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 2380 (H2380R)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect unknown
Transcript: ENSMUST00000153273
AA Change: H2380R
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: H2380R

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103502536 missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103499638 missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103498236 missense unknown
R7694:Lrrc37a UTSW 11 103504378 missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R7717:Lrrc37a UTSW 11 103504300 missense probably benign 0.01
R7841:Lrrc37a UTSW 11 103501105 missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103503042 missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103501481 missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103457961 missense unknown
R8051:Lrrc37a UTSW 11 103503126 missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103457422 missense unknown
R8097:Lrrc37a UTSW 11 103504099 missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103503057 missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103497898 missense unknown
R8311:Lrrc37a UTSW 11 103503421 missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103501585 missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103460809 missense unknown
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103456486 missense probably damaging 1.00
Z1176:Lrrc37a UTSW 11 103499034 missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103501094 missense probably benign 0.09
Z1177:Lrrc37a UTSW 11 103499967 missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103500520 missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103500598 missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103503027 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AGAGCAGAAAGTCAGTCGTC -3'
(R):5'- AACTATGCTTGAGACCACAGC -3'

Sequencing Primer
(F):5'- AAGTCAGTCGTCAGTCAGTG -3'
(R):5'- GTGGCATCGCACTTGAACCTATG -3'
Posted On2019-11-26