Incidental Mutation 'R7736:Foxk2'
ID596280
Institutional Source Beutler Lab
Gene Symbol Foxk2
Ensembl Gene ENSMUSG00000039275
Gene Nameforkhead box K2
Synonyms5730434B08Rik, Ilf1, 1110054H05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location121259990-121309896 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121299647 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 538 (Q538L)
Ref Sequence ENSEMBL: ENSMUSP00000101719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106113]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106113
AA Change: Q538L

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101719
Gene: ENSMUSG00000039275
AA Change: Q538L

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
FHA 47 119 9.96e-10 SMART
FH 247 338 2.2e-52 SMART
low complexity region 440 465 N/A INTRINSIC
low complexity region 486 498 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a fork head DNA binding domain. This protein can bind to the purine-rich motifs of the HIV long terminal repeat (LTR), and to the similar purine-rich motif in the interleukin 2 (IL2) promoter. It may be involved in the regulation of viral and cellular promoter elements. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Foxk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Foxk2 APN 11 121299734 missense probably damaging 1.00
IGL00502:Foxk2 APN 11 121297099 splice site probably benign
IGL02619:Foxk2 APN 11 121299576 splice site probably benign
IGL03067:Foxk2 APN 11 121285568 missense possibly damaging 0.87
R1843:Foxk2 UTSW 11 121285537 missense probably benign 0.01
R2153:Foxk2 UTSW 11 121260387 missense probably benign 0.08
R2847:Foxk2 UTSW 11 121260491 small insertion probably benign
R3770:Foxk2 UTSW 11 121260491 small insertion probably benign
R4024:Foxk2 UTSW 11 121285613 missense possibly damaging 0.67
R6958:Foxk2 UTSW 11 121299737 missense probably benign 0.16
R6968:Foxk2 UTSW 11 121260482 missense possibly damaging 0.87
R7558:Foxk2 UTSW 11 121288058 missense probably benign 0.00
R7902:Foxk2 UTSW 11 121299727 missense probably benign
R7985:Foxk2 UTSW 11 121299727 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAATAGCTGCAGTGGAGGTTG -3'
(R):5'- TTAAGAGCCTGCGTTCTCAG -3'

Sequencing Primer
(F):5'- CAGTGGAGGTTGGGATTAGGC -3'
(R):5'- TGCGTTCTCAGTCGCAG -3'
Posted On2019-11-26