Incidental Mutation 'R7736:Ift88'
ID 596284
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Name intraflagellar transport 88
Synonyms Tg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7736 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 57424062-57517936 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 57445664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 266 (V266G)
Ref Sequence ENSEMBL: ENSMUSP00000113768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000122063
AA Change: V266G

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040
AA Change: V266G

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000130475
Gene: ENSMUSG00000040040
AA Change: V38G

DomainStartEndE-ValueType
Pfam:DUF3808 1 164 2.7e-8 PFAM
Pfam:TPR_11 3 76 8.7e-11 PFAM
Pfam:TPR_12 3 77 3.8e-11 PFAM
Pfam:TPR_8 6 37 7e-4 PFAM
Pfam:TPR_2 7 38 1.8e-6 PFAM
Pfam:TPR_1 7 39 3.4e-9 PFAM
Pfam:TPR_7 8 41 1.9e-7 PFAM
Pfam:TPR_8 45 78 2.2e-3 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr115 A T 17: 37,610,412 L113H probably damaging Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6602:Ift88 UTSW 14 57507259 missense probably benign 0.00
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
R7766:Ift88 UTSW 14 57447654 missense possibly damaging 0.65
R8526:Ift88 UTSW 14 57445669 nonsense probably null
R9018:Ift88 UTSW 14 57438245 missense probably benign 0.20
R9289:Ift88 UTSW 14 57480742 missense probably benign
R9340:Ift88 UTSW 14 57481463 missense probably damaging 1.00
R9369:Ift88 UTSW 14 57447680 missense probably benign 0.10
R9399:Ift88 UTSW 14 57479928 missense probably benign 0.00
R9485:Ift88 UTSW 14 57438267 missense probably benign 0.00
R9712:Ift88 UTSW 14 57481396 missense probably damaging 1.00
R9759:Ift88 UTSW 14 57434799 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCATAAGTCTCATGCACGAGC -3'
(R):5'- TGTGTGCAAACAGACACAGGTG -3'

Sequencing Primer
(F):5'- TTAGTCCCCAGATCCTAGAAAGTGG -3'
(R):5'- GTGAACAGAGCAAAATACCACATCTG -3'
Posted On 2019-11-26