Incidental Mutation 'R7736:Olfr115'
ID596289
Institutional Source Beutler Lab
Gene Symbol Olfr115
Ensembl Gene ENSMUSG00000092413
Gene Nameolfactory receptor 115
SynonymsGA_x6K02T2PSCP-2070203-2069271, MOR218-11P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R7736 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location37608940-37627109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37610412 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 113 (L113H)
Ref Sequence ENSEMBL: ENSMUSP00000152172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076936] [ENSMUST00000221552] [ENSMUST00000223366]
Predicted Effect probably damaging
Transcript: ENSMUST00000076936
AA Change: L115H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076203
Gene: ENSMUSG00000092413
AA Change: L115H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 24 252 2.6e-7 PFAM
Pfam:7tm_4 31 308 3.2e-45 PFAM
Pfam:7tm_1 41 290 2.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000221552
AA Change: L113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223366
AA Change: L113H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T G 1: 71,319,964 D561A probably benign Het
Adgrg1 T C 8: 95,005,337 F204S probably benign Het
Apoa2 T C 1: 171,226,172 L72P probably damaging Het
Arhgef10 A T 8: 14,980,583 K987* probably null Het
Arrb1 A G 7: 99,539,774 D9G unknown Het
Asph A G 4: 9,621,930 S192P possibly damaging Het
Bcas1 G A 2: 170,387,164 T309M possibly damaging Het
Bcat2 C T 7: 45,585,193 T166M possibly damaging Het
Bmp5 A T 9: 75,893,790 I401L probably damaging Het
Bpifb9b G A 2: 154,312,105 G261R probably benign Het
Cd53 T A 3: 106,767,936 Y106F probably benign Het
Cdhr3 T A 12: 33,053,520 D366V probably benign Het
Ceacam10 G C 7: 24,781,211 V256L unknown Het
Cilp2 A G 8: 69,881,421 Y976H probably damaging Het
Cklf A G 8: 104,261,555 T107A possibly damaging Het
Dhx16 T A 17: 35,881,676 W167R possibly damaging Het
Dkk2 T G 3: 132,178,014 L225R probably damaging Het
Dmbt1 A T 7: 131,116,896 D1782V unknown Het
Ebag9 A T 15: 44,628,404 D64V probably damaging Het
Eif3j2 T C 18: 43,477,317 N144D possibly damaging Het
Foxk2 A T 11: 121,299,647 Q538L possibly damaging Het
Fpgt T G 3: 155,087,110 I427L probably benign Het
Ganc A T 2: 120,433,814 N416I possibly damaging Het
Gata6 A G 18: 11,084,379 Y556C probably damaging Het
Gga2 A T 7: 121,990,524 V534E probably damaging Het
Gm6904 C T 14: 59,251,145 D68N probably benign Het
Gm7324 T A 14: 43,714,799 S300T possibly damaging Het
Gprc6a A C 10: 51,615,453 N733K possibly damaging Het
Hivep3 C T 4: 120,095,543 T352I possibly damaging Het
Ift88 T G 14: 57,445,664 V266G probably benign Het
Ikbkap T C 4: 56,776,920 T626A possibly damaging Het
Ip6k1 G T 9: 108,045,692 G341V probably damaging Het
Itga3 G T 11: 95,076,203 A45E probably damaging Het
Kctd14 T A 7: 97,457,940 L134Q probably damaging Het
Lats1 C A 10: 7,702,364 N417K probably damaging Het
Lrrc37a T C 11: 103,497,459 H2380R unknown Het
Lrrc4c A G 2: 97,630,360 T444A probably benign Het
M1ap T C 6: 83,005,584 I283T probably benign Het
Mapre2 T C 18: 23,877,955 S207P probably benign Het
Moxd1 T C 10: 24,282,710 F421L probably damaging Het
Nos2 T A 11: 78,922,366 C33* probably null Het
Olfr154 T C 2: 85,664,414 T7A probably damaging Het
Olfr345 A T 2: 36,640,185 I49F probably damaging Het
Otud4 T C 8: 79,655,765 I201T possibly damaging Het
Pank4 T C 4: 154,969,747 Y128H probably benign Het
Pitpnm2 A G 5: 124,123,030 V1027A possibly damaging Het
Plcb3 A G 19: 6,969,623 V8A probably benign Het
Por A G 5: 135,731,122 E221G probably damaging Het
Prokr2 A T 2: 132,381,580 L14* probably null Het
Ptgis A G 2: 167,191,971 F459S unknown Het
Ptpru T C 4: 131,788,382 E887G probably damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Slc18a1 A G 8: 69,065,554 probably null Het
Slc27a3 A G 3: 90,389,433 S120P probably benign Het
Slc2a12 T A 10: 22,664,818 Y191N probably damaging Het
Snx29 T A 16: 11,367,724 M57K probably benign Het
Syncrip A G 9: 88,461,668 probably null Het
Taar4 T A 10: 23,960,999 V169E probably damaging Het
Tas1r1 C T 4: 152,032,466 G237D probably benign Het
Tle1 T C 4: 72,199,334 K30E probably damaging Het
Tmem131l A T 3: 83,940,568 L330Q probably damaging Het
Tmem67 A G 4: 12,053,455 F698L probably benign Het
Ttn T A 2: 76,909,230 Q3701L unknown Het
Vmn2r17 G A 5: 109,452,891 R685K probably benign Het
Ylpm1 C A 12: 85,012,983 A321E unknown Het
Zdbf2 T A 1: 63,308,007 Y1848* probably null Het
Zfand2b T A 1: 75,169,532 N61K probably null Het
Zfp867 C T 11: 59,463,190 A438T probably damaging Het
Zkscan14 G A 5: 145,195,509 T404I probably benign Het
Zrsr1 C T 11: 22,973,510 Q95* probably null Het
Other mutations in Olfr115
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01984:Olfr115 APN 17 37623661 intron probably benign
R1132:Olfr115 UTSW 17 37610442 missense possibly damaging 0.90
R1829:Olfr115 UTSW 17 37610277 missense probably benign 0.04
R1831:Olfr115 UTSW 17 37609839 missense possibly damaging 0.92
R1872:Olfr115 UTSW 17 37609912 missense probably damaging 1.00
R2140:Olfr115 UTSW 17 37610471 missense probably benign
R2142:Olfr115 UTSW 17 37610471 missense probably benign
R3079:Olfr115 UTSW 17 37610278 missense probably benign 0.07
R3080:Olfr115 UTSW 17 37610278 missense probably benign 0.07
R5250:Olfr115 UTSW 17 37609960 missense probably damaging 0.99
R5539:Olfr115 UTSW 17 37610755 start codon destroyed probably benign 0.00
R5586:Olfr115 UTSW 17 37610254 missense probably damaging 1.00
R5921:Olfr115 UTSW 17 37610219 nonsense probably null
R6469:Olfr115 UTSW 17 37610313 missense probably damaging 1.00
R6473:Olfr115 UTSW 17 37609996 missense possibly damaging 0.46
R6754:Olfr115 UTSW 17 37610155 missense probably benign
R7457:Olfr115 UTSW 17 37610565 missense possibly damaging 0.60
R7814:Olfr115 UTSW 17 37610656 missense probably benign 0.04
Z1177:Olfr115 UTSW 17 37610053 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGTGGATTATTCTGTCCCCAC -3'
(R):5'- GGGAACTGCATCATTATCACCATC -3'

Sequencing Primer
(F):5'- TCCCCACAGAATCTGATAGAGAGTG -3'
(R):5'- CAGCTCAAGTCTCCAATGTATTAC -3'
Posted On2019-11-26