Mutagenetix > Incidental Mutation

Incidental Mutation 'R7737:Brinp3'

596298

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

045793-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R7737 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 146682594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 85 (K85N)

Ref Sequence

ENSEMBL: ENSMUSP00000074201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000132847] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

probably damaging
Transcript: ENSMUST00000074622
AA Change: K85N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: K85N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000132847
AA Change: K85N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000118552
Gene: ENSMUSG00000035131
AA Change: K85N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
Blast:MACPF	78	110	1e-16	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000166814
AA Change: K85N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: K85N

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,677		probably null	Het
9530053A07Rik	T	A	7: 28,157,073	V2095E	probably damaging	Het
Adamts18	A	T	8: 113,736,934		probably null	Het
Akap3	T	A	6: 126,874,102	M861K	probably damaging	Het
Ankrd42	T	C	7: 92,605,262	T380A	possibly damaging	Het
Arhgef5	A	G	6: 43,273,794	E493G	possibly damaging	Het
Armc4	A	G	18: 7,217,890	L608P	probably damaging	Het
Arvcf	G	A	16: 18,397,101	R119Q	probably damaging	Het
Asmt	T	C	X: 170,676,440	F228S	probably damaging	Het
Atp2c2	T	A	8: 119,742,395	V349E	probably damaging	Het
BC034090	A	G	1: 155,241,673	V233A	possibly damaging	Het
Ccr6	G	A	17: 8,245,094		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Ddb1	C	T	19: 10,625,974	A882V	possibly damaging	Het
Epha4	C	T	1: 77,381,012	G783D	probably damaging	Het
Ephb1	T	A	9: 101,984,103	I621F	probably damaging	Het
Fbxw18	G	T	9: 109,701,263	Y93*	probably null	Het
Gak	A	C	5: 108,617,008	L84R	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gm5458	A	T	14: 19,599,737		probably null	Het
Gpatch3	C	G	4: 133,575,096	Q113E	probably benign	Het
Gpld1	C	A	13: 24,975,726	L426M	probably damaging	Het
Ighmbp2	G	A	19: 3,274,467	P234S	unknown	Het
Itga6	G	A	2: 71,822,443	V217I	probably benign	Het
Kdm7a	A	T	6: 39,144,404	N872K	probably benign	Het
Klhl14	G	T	18: 21,558,134	Y446*	probably null	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lct	A	T	1: 128,298,693	W1320R	probably benign	Het
Lrp2	T	C	2: 69,496,438	D1763G	possibly damaging	Het
Lrrk2	A	T	15: 91,815,446	N2499Y	probably damaging	Het
Lsg1	T	C	16: 30,581,185		probably null	Het
Mettl15	T	C	2: 109,137,378	K188E	probably damaging	Het
Mfsd4b1	A	G	10: 40,003,278	S208P	probably damaging	Het
Mlxipl	T	C	5: 135,135,381	S793P	possibly damaging	Het
Ms4a14	G	A	19: 11,302,786	Q803*	probably null	Het
Mtor	A	C	4: 148,538,738	E2015A	possibly damaging	Het
Myo15b	A	T	11: 115,887,923	Y2581F	unknown	Het
Myo7b	A	T	18: 32,014,204	Y95*	probably null	Het
Nf1	A	G	11: 79,545,488	I1985V	probably benign	Het
Noxred1	G	A	12: 87,221,362	Q332*	probably null	Het
Nudt21	A	T	8: 94,022,833	Y202N	probably damaging	Het
Olfr345	A	T	2: 36,640,620	I194F	probably benign	Het
Pik3c2a	A	T	7: 116,356,253	S1176T	probably damaging	Het
Pramef17	A	C	4: 143,991,956	S306A	possibly damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rbmxl1	A	G	8: 78,505,623	S364P	unknown	Het
Rnf24	T	A	2: 131,303,496	K131N	probably benign	Het
Scai	T	A	2: 39,123,022	Q132L	probably damaging	Het
Sh3tc1	T	C	5: 35,723,953	R49G	probably benign	Het
Slc12a7	A	G	13: 73,788,677	E152G	probably benign	Het
Slc22a27	A	T	19: 7,896,762	M316K	probably damaging	Het
Spag1	G	T	15: 36,210,710	A427S	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk16	G	T	1: 75,211,351	C8F	probably damaging	Het
Syne2	T	C	12: 75,942,848	C1834R	probably damaging	Het
Tie1	C	T	4: 118,478,857		probably null	Het
Timp2	A	G	11: 118,303,895	I156T	probably damaging	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmx4	T	A	2: 134,639,668	M112L	probably benign	Het
Trank1	G	T	9: 111,366,012	E1035*	probably null	Het
Trim5	C	T	7: 104,279,564	V57M	probably damaging	Het
Ubr3	A	G	2: 69,991,566	S1391G	probably benign	Het
Vmn1r72	A	T	7: 11,669,707	S271R	probably damaging	Het
Xpo5	G	A	17: 46,236,090		probably null	Het
Zfp592	A	T	7: 81,025,193	H635L	probably damaging	Het
Zfp791	A	T	8: 85,112,215	N62K	probably benign	Het
Zmynd11	G	A	13: 9,695,139	T248M	probably damaging	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7375:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAGTACCATGTTGCTGTTACTG -3'
(R):5'- AGTCTCCTACCTCCCAGAGTAG -3'

Sequencing Primer
(F):5'- GTAAGTGAATTTTAGATGTGCCCTC -3'
(R):5'- GCTGATAGCAAGAAATGAGTCCC -3'

Posted On

2019-11-26