Incidental Mutation 'R7737:Scai'
ID 596301
Institutional Source Beutler Lab
Gene Symbol Scai
Ensembl Gene ENSMUSG00000035236
Gene Name suppressor of cancer cell invasion
Synonyms A930041I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.501) question?
Stock # R7737 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 39066214-39190734 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39123022 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 132 (Q132L)
Ref Sequence ENSEMBL: ENSMUSP00000037194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038874] [ENSMUST00000147433] [ENSMUST00000204093] [ENSMUST00000204404]
AlphaFold Q8C8N2
Predicted Effect probably damaging
Transcript: ENSMUST00000038874
AA Change: Q132L

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037194
Gene: ENSMUSG00000035236
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:DUF3550 64 557 6.1e-216 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147433
Predicted Effect probably damaging
Transcript: ENSMUST00000204093
AA Change: Q132L

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145133
Gene: ENSMUSG00000035236
AA Change: Q132L

DomainStartEndE-ValueType
Pfam:DUF3550 64 480 2.5e-177 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204404
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of cell migration. The encoded protein appears to function in the RhoA (ras homolog gene family, member A)-Dia1 (diaphanous homolog 1) signal transduction pathway. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mice of both sexes are sub-fertile owing to compromised meiotic synapsis and homologous recombination-mediated double-strand break DNA repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Scai
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Scai APN 2 39108394 missense probably damaging 1.00
IGL01366:Scai APN 2 39106961 missense probably benign 0.36
IGL01739:Scai APN 2 39094791 splice site probably benign
IGL02251:Scai APN 2 39099417 missense probably benign 0.01
IGL02274:Scai APN 2 39102317 unclassified probably benign
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0239:Scai UTSW 2 39075042 missense probably benign 0.00
R0685:Scai UTSW 2 39103737 missense probably damaging 0.96
R0904:Scai UTSW 2 39075152 missense possibly damaging 0.90
R1655:Scai UTSW 2 39080117 missense possibly damaging 0.79
R1820:Scai UTSW 2 39106978 missense possibly damaging 0.82
R1913:Scai UTSW 2 39080081 missense probably damaging 1.00
R2068:Scai UTSW 2 39123013 missense probably damaging 1.00
R2183:Scai UTSW 2 39080126 missense probably benign 0.00
R3237:Scai UTSW 2 39150314 splice site probably benign
R3933:Scai UTSW 2 39075052 missense probably benign 0.44
R5460:Scai UTSW 2 39083573 missense probably damaging 1.00
R5460:Scai UTSW 2 39083574 missense probably damaging 1.00
R6089:Scai UTSW 2 39083554 nonsense probably null
R6377:Scai UTSW 2 39102328 missense probably benign 0.02
R6606:Scai UTSW 2 39075135 missense probably benign 0.00
R7034:Scai UTSW 2 39121135 missense probably damaging 1.00
R7037:Scai UTSW 2 39190621 missense probably benign 0.04
R7171:Scai UTSW 2 39106936 missense possibly damaging 0.48
R7451:Scai UTSW 2 39125136 missense probably damaging 1.00
R8856:Scai UTSW 2 39106966 missense probably benign 0.01
R8890:Scai UTSW 2 39150388 intron probably benign
R9040:Scai UTSW 2 39075152 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- GAACAGCTGACATGAAGAATACTGC -3'
(R):5'- CGTGACACAAATCAGTCAAGAG -3'

Sequencing Primer
(F):5'- CATCTATAGCTCACTGCCT -3'
(R):5'- TTCATGATCTTTGCTAATGAG -3'
Posted On 2019-11-26