Incidental Mutation 'R7737:Itga6'
ID596304
Institutional Source Beutler Lab
Gene Symbol Itga6
Ensembl Gene ENSMUSG00000027111
Gene Nameintegrin alpha 6
SynonymsCd49f, 5033401O05Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location71745616-71858416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71822443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 217 (V217I)
Ref Sequence ENSEMBL: ENSMUSP00000028522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028522] [ENSMUST00000112101]
Predicted Effect probably benign
Transcript: ENSMUST00000028522
AA Change: V217I

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028522
Gene: ENSMUSG00000027111
AA Change: V217I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 5e-32 SMART
SCOP:d1m1xa3 797 1017 3e-55 SMART
Pfam:Integrin_alpha 1038 1052 3.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112101
AA Change: V217I

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107729
Gene: ENSMUSG00000027111
AA Change: V217I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Int_alpha 40 101 3.12e-6 SMART
Int_alpha 254 303 2.7e-1 SMART
Int_alpha 312 368 1.46e-11 SMART
Int_alpha 373 426 9.73e-17 SMART
Int_alpha 428 483 5.83e0 SMART
SCOP:d1m1xa2 629 786 4e-32 SMART
SCOP:d1m1xa3 797 1017 4e-55 SMART
low complexity region 1058 1070 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155249
SMART Domains Protein: ENSMUSP00000118086
Gene: ENSMUSG00000027111

DomainStartEndE-ValueType
Pfam:Integrin_alpha2 58 533 4.7e-131 PFAM
transmembrane domain 609 631 N/A INTRINSIC
Pfam:Integrin_alpha 632 646 6.2e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes a protein that is a member of the integrin superfamily. Integrins are transmembrane receptors involved cell adhesion and signaling, and they are subdivided based on the heterodimer formation of alpha and beta chains. This protein has been shown to heterodimerize with beta 4 to bind laminin and to form the main component of hemidesmosomes, which mediate attachment of epithelia to basement membranes. In mouse, deficiency of this gene is associated with absence of hemidesmosomes, severe skin blistering, and early post-natal death. In humans mutations of this gene are associated with epidermolysis bullosa. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe blistering of the skin and other epithelia, absence of hemidesmosomes, altered laminin deposition in brain, and ectopic neuroblastic outgrowths on the brain and in the eye. Mutants die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Itga6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:Itga6 APN 2 71838262 splice site probably null
IGL00902:Itga6 APN 2 71849394 missense probably benign 0.39
IGL01360:Itga6 APN 2 71787326 splice site probably null
IGL01621:Itga6 APN 2 71825656 missense probably benign 0.02
IGL01877:Itga6 APN 2 71838280 missense probably benign
IGL02332:Itga6 APN 2 71838373 missense possibly damaging 0.63
IGL02556:Itga6 APN 2 71838683 missense probably benign 0.20
IGL02713:Itga6 APN 2 71816713 missense possibly damaging 0.79
IGL02811:Itga6 APN 2 71826732 missense probably damaging 0.98
IGL03171:Itga6 APN 2 71841329 critical splice donor site probably null
isle_royale UTSW 2 71787233 missense probably benign 0.04
PIT4418001:Itga6 UTSW 2 71834070 missense probably benign 0.06
R0070:Itga6 UTSW 2 71826716 unclassified probably benign
R0611:Itga6 UTSW 2 71820060 missense possibly damaging 0.84
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1404:Itga6 UTSW 2 71838716 missense probably benign
R1439:Itga6 UTSW 2 71834034 missense probably damaging 1.00
R1487:Itga6 UTSW 2 71843240 missense possibly damaging 0.87
R1713:Itga6 UTSW 2 71787202 missense probably benign
R1720:Itga6 UTSW 2 71820166 missense probably damaging 1.00
R1816:Itga6 UTSW 2 71840809 missense probably benign 0.00
R1866:Itga6 UTSW 2 71834070 missense probably benign
R2009:Itga6 UTSW 2 71816681 missense probably benign 0.26
R2018:Itga6 UTSW 2 71818484 missense probably benign 0.16
R2171:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R2189:Itga6 UTSW 2 71825617 missense probably benign 0.00
R2289:Itga6 UTSW 2 71818529 missense probably damaging 0.99
R2399:Itga6 UTSW 2 71820014 missense probably damaging 1.00
R4437:Itga6 UTSW 2 71825638 missense probably benign 0.42
R4482:Itga6 UTSW 2 71855915 missense probably damaging 1.00
R4773:Itga6 UTSW 2 71822444 missense probably benign 0.13
R4786:Itga6 UTSW 2 71838690 missense possibly damaging 0.80
R4898:Itga6 UTSW 2 71838373 missense possibly damaging 0.77
R5074:Itga6 UTSW 2 71826435 missense probably benign
R5386:Itga6 UTSW 2 71841150 missense probably damaging 1.00
R5591:Itga6 UTSW 2 71840590 missense probably damaging 1.00
R6024:Itga6 UTSW 2 71787233 missense probably benign 0.04
R6174:Itga6 UTSW 2 71833709 missense possibly damaging 0.88
R6210:Itga6 UTSW 2 71834007 critical splice acceptor site probably null
R6432:Itga6 UTSW 2 71833772 missense possibly damaging 0.75
R6644:Itga6 UTSW 2 71841124 missense probably damaging 1.00
R7354:Itga6 UTSW 2 71820230 missense probably damaging 1.00
R7402:Itga6 UTSW 2 71853553 missense probably benign 0.05
R7479:Itga6 UTSW 2 71838336 nonsense probably null
R7635:Itga6 UTSW 2 71843233 missense probably benign 0.00
R7657:Itga6 UTSW 2 71846251 missense probably benign 0.40
R7782:Itga6 UTSW 2 71841535 missense probably damaging 0.98
R8062:Itga6 UTSW 2 71841743 missense probably benign 0.11
R8312:Itga6 UTSW 2 71855953 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTACCTGCCTTCAATCCCAG -3'
(R):5'- AGAGTCACCCAGTGTCTGAG -3'

Sequencing Primer
(F):5'- TTGGTCTACAGAGTGAGTTCCAAGAC -3'
(R):5'- GGAGACAGGTGTGGTGCCTC -3'
Posted On2019-11-26