Incidental Mutation 'R7737:Rnf24'
ID596306
Institutional Source Beutler Lab
Gene Symbol Rnf24
Ensembl Gene ENSMUSG00000048911
Gene Namering finger protein 24
SynonymsC86507, 2810473M14Rik, D2Ertd504e, 4930505A13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location131298064-131352892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131303496 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 131 (K131N)
Ref Sequence ENSEMBL: ENSMUSP00000058630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059372] [ENSMUST00000110194] [ENSMUST00000150843] [ENSMUST00000165420] [ENSMUST00000183902] [ENSMUST00000184932]
Predicted Effect probably benign
Transcript: ENSMUST00000059372
AA Change: K131N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000058630
Gene: ENSMUSG00000048911
AA Change: K131N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110194
AA Change: K131N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105823
Gene: ENSMUSG00000048911
AA Change: K131N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150843
SMART Domains Protein: ENSMUSP00000119606
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 86 438 8.8e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165420
AA Change: K131N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129843
Gene: ENSMUSG00000048911
AA Change: K131N

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
RING 78 118 2.71e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183902
SMART Domains Protein: ENSMUSP00000139130
Gene: ENSMUSG00000048911

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184932
SMART Domains Protein: ENSMUSP00000139259
Gene: ENSMUSG00000037514

DomainStartEndE-ValueType
low complexity region 11 27 N/A INTRINSIC
low complexity region 28 54 N/A INTRINSIC
Pfam:Fumble 85 151 1e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that contains a RING-type zinc finger. The encoded protein may interact with multiple transient receptor potential cation channel subfamily C (TRPC) proteins and regulate the trafficking and insertion of these proteins into the plasma membrane. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Rnf24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00719:Rnf24 APN 2 131305693 missense possibly damaging 0.46
R5888:Rnf24 UTSW 2 131322245 intron probably benign
R7444:Rnf24 UTSW 2 131313295 missense probably damaging 1.00
R7661:Rnf24 UTSW 2 131322215 intron probably benign
R8086:Rnf24 UTSW 2 131303548 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GTCACAAGATCCAGATGCCTG -3'
(R):5'- CGCTGGCTTTGTGTAACTGAC -3'

Sequencing Primer
(F):5'- GCTCAAGAGTTCTTCATGAGGC -3'
(R):5'- GCTTTGTGTAACTGACAGTCTC -3'
Posted On2019-11-26