Incidental Mutation 'R7737:Mtor'
ID596310
Institutional Source Beutler Lab
Gene Symbol Mtor
Ensembl Gene ENSMUSG00000028991
Gene Namemechanistic target of rapamycin kinase
SynonymsRAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location148448611-148557683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 148538738 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 2015 (E2015A)
Ref Sequence ENSEMBL: ENSMUSP00000099510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103221]
Predicted Effect possibly damaging
Transcript: ENSMUST00000103221
AA Change: E2015A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: E2015A

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 179 191 N/A INTRINSIC
low complexity region 277 288 N/A INTRINSIC
low complexity region 774 790 N/A INTRINSIC
DUF3385 854 1024 1.51e-93 SMART
low complexity region 1279 1300 N/A INTRINSIC
Pfam:FAT 1513 1908 2.3e-134 PFAM
Rapamycin_bind 2015 2114 7.94e-61 SMART
PI3Kc 2183 2484 8.84e-121 SMART
FATC 2517 2549 2.11e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Mtor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Mtor APN 4 148453037 missense probably benign 0.06
IGL01447:Mtor APN 4 148530757 missense possibly damaging 0.62
IGL01551:Mtor APN 4 148472037 missense probably damaging 0.99
IGL01661:Mtor APN 4 148514851 missense possibly damaging 0.61
IGL01675:Mtor APN 4 148484654 missense probably benign 0.00
IGL01743:Mtor APN 4 148530613 splice site probably benign
IGL02015:Mtor APN 4 148540113 nonsense probably null
IGL02084:Mtor APN 4 148470680 missense probably damaging 0.98
IGL02095:Mtor APN 4 148544541 missense probably damaging 1.00
IGL02129:Mtor APN 4 148549845 missense possibly damaging 0.91
IGL02260:Mtor APN 4 148538301 missense probably damaging 1.00
IGL02329:Mtor APN 4 148534939 missense probably benign 0.16
IGL02440:Mtor APN 4 148546429 missense probably benign 0.24
IGL02440:Mtor APN 4 148491647 missense probably benign 0.04
IGL02449:Mtor APN 4 148533921 missense possibly damaging 0.65
IGL02479:Mtor APN 4 148470584 missense probably damaging 1.00
IGL02904:Mtor APN 4 148452394 missense possibly damaging 0.55
IGL02904:Mtor APN 4 148491612 splice site probably benign
IGL02931:Mtor APN 4 148464964 missense probably benign 0.22
IGL03048:Mtor APN 4 148546390 splice site probably benign
IGL03133:Mtor APN 4 148484319 missense probably benign 0.01
IGL03142:Mtor APN 4 148453899 missense probably benign 0.00
Dynamo UTSW 4 148462910 missense probably benign 0.00
engine UTSW 4 148556855 splice site probably null
Erg UTSW 4 148545596 missense probably damaging 1.00
Lindor UTSW 4 148454646 missense probably damaging 1.00
motor UTSW 4 148491360 missense possibly damaging 0.76
Vim UTSW 4 148525803 critical splice donor site probably null
PIT4519001:Mtor UTSW 4 148524500 missense probably damaging 1.00
R0045:Mtor UTSW 4 148464949 missense probably benign 0.42
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0048:Mtor UTSW 4 148538881 nonsense probably null
R0103:Mtor UTSW 4 148533902 missense probably benign 0.05
R0112:Mtor UTSW 4 148480923 missense probably damaging 1.00
R0137:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R0184:Mtor UTSW 4 148464971 missense probably benign 0.05
R0208:Mtor UTSW 4 148464975 missense probably benign 0.43
R0329:Mtor UTSW 4 148484380 missense probably benign
R0330:Mtor UTSW 4 148484380 missense probably benign
R0365:Mtor UTSW 4 148486050 missense probably benign 0.01
R0537:Mtor UTSW 4 148538360 missense probably damaging 1.00
R0542:Mtor UTSW 4 148540450 missense probably benign 0.02
R0556:Mtor UTSW 4 148469380 missense possibly damaging 0.88
R0613:Mtor UTSW 4 148526046 missense possibly damaging 0.95
R0646:Mtor UTSW 4 148484354 nonsense probably null
R0710:Mtor UTSW 4 148464391 missense possibly damaging 0.73
R0791:Mtor UTSW 4 148462910 missense probably benign 0.00
R0792:Mtor UTSW 4 148462910 missense probably benign 0.00
R0866:Mtor UTSW 4 148486056 missense probably benign 0.04
R0973:Mtor UTSW 4 148550188 missense probably damaging 1.00
R1027:Mtor UTSW 4 148539999 missense probably benign 0.03
R1028:Mtor UTSW 4 148538830 missense possibly damaging 0.88
R1289:Mtor UTSW 4 148470307 missense probably benign 0.10
R1416:Mtor UTSW 4 148491414 nonsense probably null
R1465:Mtor UTSW 4 148525993 splice site probably benign
R1506:Mtor UTSW 4 148536505 splice site probably benign
R1624:Mtor UTSW 4 148547676 missense probably damaging 1.00
R1695:Mtor UTSW 4 148538907 missense probably benign 0.08
R1771:Mtor UTSW 4 148470624 missense possibly damaging 0.78
R1800:Mtor UTSW 4 148462892 missense probably benign 0.00
R1855:Mtor UTSW 4 148553089 missense probably benign 0.02
R1857:Mtor UTSW 4 148480879 missense probably damaging 1.00
R1867:Mtor UTSW 4 148454632 missense probably damaging 0.97
R1954:Mtor UTSW 4 148468273 missense probably damaging 1.00
R2054:Mtor UTSW 4 148462852 missense probably benign 0.05
R2054:Mtor UTSW 4 148466025 missense probably benign 0.00
R2099:Mtor UTSW 4 148550192 nonsense probably null
R2148:Mtor UTSW 4 148456012 missense possibly damaging 0.56
R2214:Mtor UTSW 4 148538870 missense probably benign 0.39
R2281:Mtor UTSW 4 148489555 missense probably benign 0.02
R2512:Mtor UTSW 4 148530491 missense possibly damaging 0.95
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2870:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2871:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2872:Mtor UTSW 4 148540030 missense probably benign 0.00
R2873:Mtor UTSW 4 148540030 missense probably benign 0.00
R4032:Mtor UTSW 4 148536752 missense probably benign 0.03
R4073:Mtor UTSW 4 148549375 missense probably damaging 0.99
R4273:Mtor UTSW 4 148550152 missense probably benign 0.21
R4611:Mtor UTSW 4 148486119 missense probably benign 0.03
R4858:Mtor UTSW 4 148454816 makesense probably null
R4942:Mtor UTSW 4 148472142 missense probably benign 0.03
R4967:Mtor UTSW 4 148491360 missense possibly damaging 0.76
R4995:Mtor UTSW 4 148525752 missense probably damaging 1.00
R5054:Mtor UTSW 4 148556855 splice site probably null
R5215:Mtor UTSW 4 148453983 missense probably benign
R5249:Mtor UTSW 4 148463732 missense probably damaging 1.00
R5289:Mtor UTSW 4 148466092 missense possibly damaging 0.88
R5365:Mtor UTSW 4 148550130 missense probably damaging 0.99
R5498:Mtor UTSW 4 148540364 missense possibly damaging 0.71
R5514:Mtor UTSW 4 148546444 missense probably damaging 1.00
R5540:Mtor UTSW 4 148454708 missense probably benign 0.01
R5600:Mtor UTSW 4 148491470 missense probably damaging 1.00
R5615:Mtor UTSW 4 148538276 missense possibly damaging 0.95
R5632:Mtor UTSW 4 148469006 missense possibly damaging 0.94
R5641:Mtor UTSW 4 148546425 missense probably damaging 0.98
R5834:Mtor UTSW 4 148536536 missense possibly damaging 0.95
R5984:Mtor UTSW 4 148538827 missense probably benign 0.02
R6056:Mtor UTSW 4 148537435 missense probably benign 0.00
R6225:Mtor UTSW 4 148521337 missense probably benign 0.04
R6262:Mtor UTSW 4 148526095 missense possibly damaging 0.46
R6335:Mtor UTSW 4 148465927 missense probably damaging 1.00
R6479:Mtor UTSW 4 148551000 missense probably benign 0.16
R6543:Mtor UTSW 4 148545596 missense probably damaging 1.00
R6711:Mtor UTSW 4 148452367 missense possibly damaging 0.49
R6715:Mtor UTSW 4 148538547 missense probably benign 0.00
R6744:Mtor UTSW 4 148458655 missense probably benign 0.01
R6748:Mtor UTSW 4 148550184 missense probably damaging 1.00
R6762:Mtor UTSW 4 148538481 missense possibly damaging 0.47
R6836:Mtor UTSW 4 148489498 missense possibly damaging 0.94
R6948:Mtor UTSW 4 148536752 missense probably benign 0.12
R6979:Mtor UTSW 4 148524473 missense possibly damaging 0.60
R6992:Mtor UTSW 4 148464475 missense probably benign
R7271:Mtor UTSW 4 148546485 missense possibly damaging 0.70
R7423:Mtor UTSW 4 148556344 missense possibly damaging 0.77
R7434:Mtor UTSW 4 148464959 missense probably benign 0.39
R7619:Mtor UTSW 4 148462795 missense probably damaging 0.98
R7634:Mtor UTSW 4 148452350 missense possibly damaging 0.53
R7697:Mtor UTSW 4 148540308 nonsense probably null
R7791:Mtor UTSW 4 148462940 missense probably benign 0.00
R7858:Mtor UTSW 4 148454646 missense probably damaging 1.00
R8035:Mtor UTSW 4 148546399 missense probably benign 0.29
R8076:Mtor UTSW 4 148525803 critical splice donor site probably null
R8078:Mtor UTSW 4 148468287 missense probably benign
X0025:Mtor UTSW 4 148530714 missense probably benign 0.09
Z1176:Mtor UTSW 4 148550125 missense probably benign 0.08
Z1176:Mtor UTSW 4 148550130 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GTGTGAACACAGCAACACGC -3'
(R):5'- GAGGTAGGATAATGTTCTGTCACTC -3'

Sequencing Primer
(F):5'- GCAACACGCTGGTCCAG -3'
(R):5'- AGGATAATGTTCTGTCACTCTGATC -3'
Posted On2019-11-26