Mutagenetix > Incidental Mutations

Incidental Mutation 'R7737:Mtor'

596310

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7737 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 148538738 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Alanine at position 2015 (E2015A)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103221
AA Change: E2015A

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: E2015A

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,677		probably null	Het
9530053A07Rik	T	A	7: 28,157,073	V2095E	probably damaging	Het
Akap3	T	A	6: 126,874,102	M861K	probably damaging	Het
Ankrd42	T	C	7: 92,605,262	T380A	possibly damaging	Het
Arhgef5	A	G	6: 43,273,794	E493G	possibly damaging	Het
Armc4	A	G	18: 7,217,890	L608P	probably damaging	Het
Arvcf	G	A	16: 18,397,101	R119Q	probably damaging	Het
Asmt	T	C	X: 170,676,440	F228S	probably damaging	Het
Atp2c2	T	A	8: 119,742,395	V349E	probably damaging	Het
BC034090	A	G	1: 155,241,673	V233A	possibly damaging	Het
Brinp3	G	T	1: 146,682,594	K85N	probably damaging	Het
Ccr6	G	A	17: 8,245,094		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Ddb1	C	T	19: 10,625,974	A882V	possibly damaging	Het
Epha4	C	T	1: 77,381,012	G783D	probably damaging	Het
Ephb1	T	A	9: 101,984,103	I621F	probably damaging	Het
Fbxw18	G	T	9: 109,701,263	Y93*	probably null	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gpatch3	C	G	4: 133,575,096	Q113E	probably benign	Het
Gpld1	C	A	13: 24,975,726	L426M	probably damaging	Het
Itga6	G	A	2: 71,822,443	V217I	probably benign	Het
Kdm7a	A	T	6: 39,144,404	N872K	probably benign	Het
Klhl14	G	T	18: 21,558,134	Y446*	probably null	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lct	A	T	1: 128,298,693	W1320R	probably benign	Het
Lrp2	T	C	2: 69,496,438	D1763G	possibly damaging	Het
Lrrk2	A	T	15: 91,815,446	N2499Y	probably damaging	Het
Mettl15	T	C	2: 109,137,378	K188E	probably damaging	Het
Mfsd4b1	A	G	10: 40,003,278	S208P	probably damaging	Het
Mlxipl	T	C	5: 135,135,381	S793P	possibly damaging	Het
Ms4a14	G	A	19: 11,302,786	Q803*	probably null	Het
Myo15b	A	T	11: 115,887,923	Y2581F	unknown	Het
Myo7b	A	T	18: 32,014,204	Y95*	probably null	Het
Nf1	A	G	11: 79,545,488	I1985V	probably benign	Het
Noxred1	G	A	12: 87,221,362	Q332*	probably null	Het
Nudt21	A	T	8: 94,022,833	Y202N	probably damaging	Het
Olfr345	A	T	2: 36,640,620	I194F	probably benign	Het
Pik3c2a	A	T	7: 116,356,253	S1176T	probably damaging	Het
Pramef17	A	C	4: 143,991,956	S306A	possibly damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rbmxl1	A	G	8: 78,505,623	S364P	unknown	Het
Rnf24	T	A	2: 131,303,496	K131N	probably benign	Het
Scai	T	A	2: 39,123,022	Q132L	probably damaging	Het
Sh3tc1	T	C	5: 35,723,953	R49G	probably benign	Het
Slc12a7	A	G	13: 73,788,677	E152G	probably benign	Het
Slc22a27	A	T	19: 7,896,762	M316K	probably damaging	Het
Spag1	G	T	15: 36,210,710	A427S	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk16	G	T	1: 75,211,351	C8F	probably damaging	Het
Syne2	T	C	12: 75,942,848	C1834R	probably damaging	Het
Timp2	A	G	11: 118,303,895	I156T	probably damaging	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmx4	T	A	2: 134,639,668	M112L	probably benign	Het
Trank1	G	T	9: 111,366,012	E1035*	probably null	Het
Trim5	C	T	7: 104,279,564	V57M	probably damaging	Het
Ubr3	A	G	2: 69,991,566	S1391G	probably benign	Het
Vmn1r72	A	T	7: 11,669,707	S271R	probably damaging	Het
Zfp592	A	T	7: 81,025,193	H635L	probably damaging	Het
Zfp791	A	T	8: 85,112,215	N62K	probably benign	Het
Zmynd11	G	A	13: 9,695,139	T248M	probably damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	unclassified	probably null
motor	UTSW	4	148491360	missense	possibly damaging	0.76
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0613:Mtor	UTSW	4	148526046	missense	possibly damaging	0.95
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148539999	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4942:Mtor	UTSW	4	148472142	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	unclassified	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148538276	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148538547	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148454646	missense	probably damaging	1.00
R7941:Mtor	UTSW	4	148454646	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148546399	missense	not run
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148550125	missense	not run
Z1176:Mtor	UTSW	4	148550130	missense	not run

Predicted Primers

PCR Primer
(F):5'- GTGTGAACACAGCAACACGC -3'
(R):5'- GAGGTAGGATAATGTTCTGTCACTC -3'

Sequencing Primer
(F):5'- GCAACACGCTGGTCCAG -3'
(R):5'- AGGATAATGTTCTGTCACTCTGATC -3'

Posted On

2019-11-26