Mutagenetix > Incidental Mutation

Incidental Mutation 'R7737:Mlxipl'

596313

Institutional Source

Beutler Lab

Gene Symbol

Mlxipl

Ensembl Gene

ENSMUSG00000005373

Gene Name

MLX interacting protein-like

Synonyms

WS-bHLH, Wbscr14, bHLHd14, ChREBP

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.354) question?

Stock #

R7737 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135089890-135138382 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 135135381 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 793 (S793P)

Ref Sequence

ENSEMBL: ENSMUSP00000005507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005507] [ENSMUST00000128691] [ENSMUST00000129008] [ENSMUST00000142385] [ENSMUST00000153519]

AlphaFold

Q99MZ3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000005507
AA Change: S793P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000005507
Gene: ENSMUSG00000005373
AA Change: S793P

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	1e-8	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
HLH	667	721	1.14e-9	SMART

Predicted Effect

SMART Domains

Protein: ENSMUSP00000116358
Gene: ENSMUSG00000005373
AA Change: S144P

Domain	Start	End	E-Value	Type
HLH	19	73	1.14e-9	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128691

SMART Domains

Protein: ENSMUSP00000121348
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1hloa_	658	709	6e-7	SMART
Blast:HLH	667	699	1e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000129008

SMART Domains

Protein: ENSMUSP00000114933
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142385

SMART Domains

Protein: ENSMUSP00000144328
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	7e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153519

SMART Domains

Protein: ENSMUSP00000122198
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
low complexity region	19	34	N/A	INTRINSIC
PDB:4GNT\|B	117	137	9e-9	PDB
low complexity region	261	271	N/A	INTRINSIC
low complexity region	341	350	N/A	INTRINSIC
low complexity region	387	408	N/A	INTRINSIC
low complexity region	414	437	N/A	INTRINSIC
low complexity region	457	473	N/A	INTRINSIC
low complexity region	513	531	N/A	INTRINSIC
low complexity region	574	603	N/A	INTRINSIC
SCOP:d1am9a_	658	696	1e-5	SMART
Blast:HLH	667	698	2e-12	BLAST
low complexity region	728	744	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000154840

SMART Domains

Protein: ENSMUSP00000121668
Gene: ENSMUSG00000005373

Domain	Start	End	E-Value	Type
HLH	26	120	7.9e-4	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basic helix-loop-helix leucine zipper transcription factor of the Myc/Max/Mad superfamily. This protein forms a heterodimeric complex and binds and activates, in a glucose-dependent manner, carbohydrate response element (ChoRE) motifs in the promoters of triglyceride synthesis genes. The gene is deleted in Williams-Beuren syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at chromosome 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced glycolysis and lipogenesis and severe simple carbohydrate intolerance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,677		probably null	Het
9530053A07Rik	T	A	7: 28,157,073	V2095E	probably damaging	Het
Adamts18	A	T	8: 113,736,934		probably null	Het
Akap3	T	A	6: 126,874,102	M861K	probably damaging	Het
Ankrd42	T	C	7: 92,605,262	T380A	possibly damaging	Het
Arhgef5	A	G	6: 43,273,794	E493G	possibly damaging	Het
Armc4	A	G	18: 7,217,890	L608P	probably damaging	Het
Arvcf	G	A	16: 18,397,101	R119Q	probably damaging	Het
Asmt	T	C	X: 170,676,440	F228S	probably damaging	Het
Atp2c2	T	A	8: 119,742,395	V349E	probably damaging	Het
BC034090	A	G	1: 155,241,673	V233A	possibly damaging	Het
Brinp3	G	T	1: 146,682,594	K85N	probably damaging	Het
Ccr6	G	A	17: 8,245,094		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Ddb1	C	T	19: 10,625,974	A882V	possibly damaging	Het
Epha4	C	T	1: 77,381,012	G783D	probably damaging	Het
Ephb1	T	A	9: 101,984,103	I621F	probably damaging	Het
Fbxw18	G	T	9: 109,701,263	Y93*	probably null	Het
Gak	A	C	5: 108,617,008	L84R	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gm5458	A	T	14: 19,599,737		probably null	Het
Gpatch3	C	G	4: 133,575,096	Q113E	probably benign	Het
Gpld1	C	A	13: 24,975,726	L426M	probably damaging	Het
Ighmbp2	G	A	19: 3,274,467	P234S	unknown	Het
Itga6	G	A	2: 71,822,443	V217I	probably benign	Het
Kdm7a	A	T	6: 39,144,404	N872K	probably benign	Het
Klhl14	G	T	18: 21,558,134	Y446*	probably null	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lct	A	T	1: 128,298,693	W1320R	probably benign	Het
Lrp2	T	C	2: 69,496,438	D1763G	possibly damaging	Het
Lrrk2	A	T	15: 91,815,446	N2499Y	probably damaging	Het
Lsg1	T	C	16: 30,581,185		probably null	Het
Mettl15	T	C	2: 109,137,378	K188E	probably damaging	Het
Mfsd4b1	A	G	10: 40,003,278	S208P	probably damaging	Het
Ms4a14	G	A	19: 11,302,786	Q803*	probably null	Het
Mtor	A	C	4: 148,538,738	E2015A	possibly damaging	Het
Myo15b	A	T	11: 115,887,923	Y2581F	unknown	Het
Myo7b	A	T	18: 32,014,204	Y95*	probably null	Het
Nf1	A	G	11: 79,545,488	I1985V	probably benign	Het
Noxred1	G	A	12: 87,221,362	Q332*	probably null	Het
Nudt21	A	T	8: 94,022,833	Y202N	probably damaging	Het
Olfr345	A	T	2: 36,640,620	I194F	probably benign	Het
Pik3c2a	A	T	7: 116,356,253	S1176T	probably damaging	Het
Pramef17	A	C	4: 143,991,956	S306A	possibly damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rbmxl1	A	G	8: 78,505,623	S364P	unknown	Het
Rnf24	T	A	2: 131,303,496	K131N	probably benign	Het
Scai	T	A	2: 39,123,022	Q132L	probably damaging	Het
Sh3tc1	T	C	5: 35,723,953	R49G	probably benign	Het
Slc12a7	A	G	13: 73,788,677	E152G	probably benign	Het
Slc22a27	A	T	19: 7,896,762	M316K	probably damaging	Het
Spag1	G	T	15: 36,210,710	A427S	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk16	G	T	1: 75,211,351	C8F	probably damaging	Het
Syne2	T	C	12: 75,942,848	C1834R	probably damaging	Het
Tie1	C	T	4: 118,478,857		probably null	Het
Timp2	A	G	11: 118,303,895	I156T	probably damaging	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmx4	T	A	2: 134,639,668	M112L	probably benign	Het
Trank1	G	T	9: 111,366,012	E1035*	probably null	Het
Trim5	C	T	7: 104,279,564	V57M	probably damaging	Het
Ubr3	A	G	2: 69,991,566	S1391G	probably benign	Het
Vmn1r72	A	T	7: 11,669,707	S271R	probably damaging	Het
Xpo5	G	A	17: 46,236,090		probably null	Het
Zfp592	A	T	7: 81,025,193	H635L	probably damaging	Het
Zfp791	A	T	8: 85,112,215	N62K	probably benign	Het
Zmynd11	G	A	13: 9,695,139	T248M	probably damaging	Het

Other mutations in Mlxipl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Mlxipl	APN	5	135132778	missense	probably damaging	0.98
IGL01872:Mlxipl	APN	5	135113691	missense	probably damaging	1.00
IGL02694:Mlxipl	APN	5	135124018	critical splice donor site	probably null
IGL03070:Mlxipl	APN	5	135132453	missense	possibly damaging	0.93
Scarlet	UTSW	5	135134030	missense	possibly damaging	0.93
H8441:Mlxipl	UTSW	5	135123961	missense	probably damaging	1.00
IGL03054:Mlxipl	UTSW	5	135133256	missense	possibly damaging	0.83
R0003:Mlxipl	UTSW	5	135133189	unclassified	probably benign
R0126:Mlxipl	UTSW	5	135132323	missense	probably damaging	0.96
R0458:Mlxipl	UTSW	5	135133370	missense	probably benign	0.33
R0513:Mlxipl	UTSW	5	135137263	missense	probably benign	0.33
R0580:Mlxipl	UTSW	5	135123975	missense	probably benign	0.01
R0744:Mlxipl	UTSW	5	135132475	missense	possibly damaging	0.86
R0827:Mlxipl	UTSW	5	135132738	missense	probably benign	0.00
R1052:Mlxipl	UTSW	5	135113710	missense	probably damaging	1.00
R1241:Mlxipl	UTSW	5	135132718	missense	probably benign	0.01
R1795:Mlxipl	UTSW	5	135107170	missense	probably damaging	1.00
R1903:Mlxipl	UTSW	5	135133568	missense	possibly damaging	0.92
R2038:Mlxipl	UTSW	5	135106999	missense	probably damaging	1.00
R2064:Mlxipl	UTSW	5	135132777	missense	possibly damaging	0.77
R2069:Mlxipl	UTSW	5	135107005	missense	probably damaging	1.00
R2081:Mlxipl	UTSW	5	135113638	missense	probably damaging	1.00
R2095:Mlxipl	UTSW	5	135122120	splice site	probably benign
R3114:Mlxipl	UTSW	5	135133662	splice site	probably benign
R4018:Mlxipl	UTSW	5	135132672	missense	probably damaging	1.00
R4090:Mlxipl	UTSW	5	135132527	missense	probably benign	0.33
R4321:Mlxipl	UTSW	5	135135450	nonsense	probably null
R4414:Mlxipl	UTSW	5	135137399	unclassified	probably benign
R5706:Mlxipl	UTSW	5	135133604	missense	probably benign	0.33
R6088:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R6508:Mlxipl	UTSW	5	135128620	missense	probably benign	0.03
R6704:Mlxipl	UTSW	5	135137240	critical splice acceptor site	probably null
R7060:Mlxipl	UTSW	5	135132315	missense	possibly damaging	0.88
R7095:Mlxipl	UTSW	5	135134030	missense	possibly damaging	0.93
R7128:Mlxipl	UTSW	5	135133851	missense	probably damaging	0.98
R7464:Mlxipl	UTSW	5	135133628	missense	probably benign	0.01
R7510:Mlxipl	UTSW	5	135133118	missense	possibly damaging	0.72
R7669:Mlxipl	UTSW	5	135132370	missense	possibly damaging	0.53
R7806:Mlxipl	UTSW	5	135134543	missense	possibly damaging	0.93
R7910:Mlxipl	UTSW	5	135132409	missense	possibly damaging	0.85
R8118:Mlxipl	UTSW	5	135137248	missense	possibly damaging	0.96
R8363:Mlxipl	UTSW	5	135107076	missense	probably benign	0.18
R8701:Mlxipl	UTSW	5	135107191	missense	possibly damaging	0.53
R8725:Mlxipl	UTSW	5	135128629	missense	probably benign	0.01
R9235:Mlxipl	UTSW	5	135128687	missense	possibly damaging	0.86
R9566:Mlxipl	UTSW	5	135123762	missense	not run

Predicted Primers

PCR Primer
(F):5'- GGTGAGTGGATAACCCTTGG -3'
(R):5'- TGCGTGCACATGTGTACATATG -3'

Sequencing Primer
(F):5'- CCTTGGTGGGAGCGAAAAG -3'
(R):5'- TCACTGGAAATTGAACTCAGGGTC -3'

Posted On

2019-11-26