Incidental Mutation 'R7737:Kdm7a'
ID 596314
Institutional Source Beutler Lab
Gene Symbol Kdm7a
Ensembl Gene ENSMUSG00000042599
Gene Name lysine (K)-specific demethylase 7A
Synonyms Kdm7a, Jhdm1d, ENSMUSG00000073143, A630082K20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7737 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 39136623-39206789 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 39144404 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 872 (N872K)
Ref Sequence ENSEMBL: ENSMUSP00000002305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002305]
AlphaFold Q3UWM4
Predicted Effect probably benign
Transcript: ENSMUST00000002305
AA Change: N872K

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000002305
Gene: ENSMUSG00000042599
AA Change: N872K

DomainStartEndE-ValueType
low complexity region 2 38 N/A INTRINSIC
PHD 39 86 8.64e-9 SMART
low complexity region 186 197 N/A INTRINSIC
JmjC 230 386 1.09e-49 SMART
low complexity region 408 419 N/A INTRINSIC
low complexity region 653 668 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype PHENOTYPE: Homozygous mutants exhibit abnormal hair follicle, tail, sebaceous gland, rib, and vertebrae morphology and decreased circulating iron levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Kdm7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kdm7a APN 6 39144510 missense probably benign
IGL00976:Kdm7a APN 6 39144398 missense possibly damaging 0.90
IGL01063:Kdm7a APN 6 39165130 missense probably damaging 0.98
IGL01325:Kdm7a APN 6 39158309 splice site probably benign
IGL01710:Kdm7a APN 6 39175386 missense probably benign 0.06
IGL01953:Kdm7a APN 6 39146902 missense probably benign 0.10
IGL02336:Kdm7a APN 6 39170264 missense probably damaging 1.00
IGL02721:Kdm7a APN 6 39173437 missense possibly damaging 0.93
IGL02963:Kdm7a APN 6 39143230 missense probably damaging 1.00
IGL03165:Kdm7a APN 6 39170914 splice site probably benign
R0033:Kdm7a UTSW 6 39165197 nonsense probably null
R0831:Kdm7a UTSW 6 39166765 splice site probably benign
R0920:Kdm7a UTSW 6 39151322 missense probably damaging 1.00
R0962:Kdm7a UTSW 6 39147194 missense probably benign 0.05
R1403:Kdm7a UTSW 6 39151253 splice site probably benign
R1632:Kdm7a UTSW 6 39152898 missense probably benign 0.15
R1759:Kdm7a UTSW 6 39147699 splice site probably null
R2143:Kdm7a UTSW 6 39168950 missense possibly damaging 0.61
R2197:Kdm7a UTSW 6 39146936 missense probably damaging 0.98
R2496:Kdm7a UTSW 6 39170763 splice site probably null
R3844:Kdm7a UTSW 6 39181579 missense probably damaging 1.00
R4083:Kdm7a UTSW 6 39152814 missense probably damaging 1.00
R4184:Kdm7a UTSW 6 39148977 missense probably benign
R4193:Kdm7a UTSW 6 39169096 missense probably damaging 1.00
R4402:Kdm7a UTSW 6 39166668 missense probably null 1.00
R4544:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4546:Kdm7a UTSW 6 39175472 missense probably benign 0.08
R4560:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4561:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4562:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4563:Kdm7a UTSW 6 39152823 missense probably damaging 0.96
R4737:Kdm7a UTSW 6 39152839 missense possibly damaging 0.57
R5061:Kdm7a UTSW 6 39151452 missense possibly damaging 0.88
R5247:Kdm7a UTSW 6 39144456 missense probably benign 0.00
R5430:Kdm7a UTSW 6 39149342 missense possibly damaging 0.85
R6248:Kdm7a UTSW 6 39147049 missense possibly damaging 0.63
R6254:Kdm7a UTSW 6 39170269 missense probably damaging 1.00
R6346:Kdm7a UTSW 6 39151211 splice site probably null
R6420:Kdm7a UTSW 6 39165168 missense probably damaging 1.00
R6908:Kdm7a UTSW 6 39144439 missense possibly damaging 0.79
R6966:Kdm7a UTSW 6 39152839 missense probably damaging 1.00
R7048:Kdm7a UTSW 6 39169048 missense probably damaging 1.00
R7087:Kdm7a UTSW 6 39175381 missense probably benign 0.18
R7450:Kdm7a UTSW 6 39143251 missense probably damaging 1.00
R8172:Kdm7a UTSW 6 39149031 missense probably benign 0.00
R8223:Kdm7a UTSW 6 39149301 missense probably damaging 1.00
R8337:Kdm7a UTSW 6 39145527 missense probably benign 0.00
R8950:Kdm7a UTSW 6 39146969 missense probably benign
R8996:Kdm7a UTSW 6 39152852 missense probably benign 0.21
R9421:Kdm7a UTSW 6 39152829 missense possibly damaging 0.83
R9497:Kdm7a UTSW 6 39151319 missense probably damaging 1.00
R9506:Kdm7a UTSW 6 39149371 missense probably benign 0.08
R9523:Kdm7a UTSW 6 39170833 missense probably damaging 1.00
R9630:Kdm7a UTSW 6 39173305 missense probably damaging 0.96
RF012:Kdm7a UTSW 6 39206513 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTCCCCACCTACTACAACTG -3'
(R):5'- GCTAATGCAGAGAAAGCTTTAAATACC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GGACTTAAGTAGAAGCCAGA -3'
Posted On 2019-11-26