Mutagenetix > Incidental Mutation

Incidental Mutation 'R7737:Arhgef5'

596315

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7737 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43273794 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 493 (E493G)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031750
AA Change: E493G

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: E493G

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000182924

Meta Mutation Damage Score

0.1007

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (63/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410141K09Rik	A	G	13: 66,433,677		probably null	Het
9530053A07Rik	T	A	7: 28,157,073	V2095E	probably damaging	Het
Adamts18	A	T	8: 113,736,934		probably null	Het
Akap3	T	A	6: 126,874,102	M861K	probably damaging	Het
Ankrd42	T	C	7: 92,605,262	T380A	possibly damaging	Het
Armc4	A	G	18: 7,217,890	L608P	probably damaging	Het
Arvcf	G	A	16: 18,397,101	R119Q	probably damaging	Het
Asmt	T	C	X: 170,676,440	F228S	probably damaging	Het
Atp2c2	T	A	8: 119,742,395	V349E	probably damaging	Het
BC034090	A	G	1: 155,241,673	V233A	possibly damaging	Het
Brinp3	G	T	1: 146,682,594	K85N	probably damaging	Het
Ccr6	G	A	17: 8,245,094		probably benign	Het
D7Ertd443e	A	G	7: 134,270,201	S644P	probably damaging	Het
Ddb1	C	T	19: 10,625,974	A882V	possibly damaging	Het
Epha4	C	T	1: 77,381,012	G783D	probably damaging	Het
Ephb1	T	A	9: 101,984,103	I621F	probably damaging	Het
Fbxw18	G	T	9: 109,701,263	Y93*	probably null	Het
Gak	A	C	5: 108,617,008	L84R	probably benign	Het
Gm21671	AACT	A	5: 25,950,851		probably benign	Het
Gm5458	A	T	14: 19,599,737		probably null	Het
Gpatch3	C	G	4: 133,575,096	Q113E	probably benign	Het
Gpld1	C	A	13: 24,975,726	L426M	probably damaging	Het
Ighmbp2	G	A	19: 3,274,467	P234S	unknown	Het
Itga6	G	A	2: 71,822,443	V217I	probably benign	Het
Kdm7a	A	T	6: 39,144,404	N872K	probably benign	Het
Klhl14	G	T	18: 21,558,134	Y446*	probably null	Het
Larp4b	T	A	13: 9,170,643		probably null	Het
Lct	A	T	1: 128,298,693	W1320R	probably benign	Het
Lrp2	T	C	2: 69,496,438	D1763G	possibly damaging	Het
Lrrk2	A	T	15: 91,815,446	N2499Y	probably damaging	Het
Lsg1	T	C	16: 30,581,185		probably null	Het
Mettl15	T	C	2: 109,137,378	K188E	probably damaging	Het
Mfsd4b1	A	G	10: 40,003,278	S208P	probably damaging	Het
Mlxipl	T	C	5: 135,135,381	S793P	possibly damaging	Het
Ms4a14	G	A	19: 11,302,786	Q803*	probably null	Het
Mtor	A	C	4: 148,538,738	E2015A	possibly damaging	Het
Myo15b	A	T	11: 115,887,923	Y2581F	unknown	Het
Myo7b	A	T	18: 32,014,204	Y95*	probably null	Het
Nf1	A	G	11: 79,545,488	I1985V	probably benign	Het
Noxred1	G	A	12: 87,221,362	Q332*	probably null	Het
Nudt21	A	T	8: 94,022,833	Y202N	probably damaging	Het
Olfr345	A	T	2: 36,640,620	I194F	probably benign	Het
Pik3c2a	A	T	7: 116,356,253	S1176T	probably damaging	Het
Pramef17	A	C	4: 143,991,956	S306A	possibly damaging	Het
Qrich2	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG	11: 116,457,541		probably benign	Het
Rbmxl1	A	G	8: 78,505,623	S364P	unknown	Het
Rnf24	T	A	2: 131,303,496	K131N	probably benign	Het
Scai	T	A	2: 39,123,022	Q132L	probably damaging	Het
Sh3tc1	T	C	5: 35,723,953	R49G	probably benign	Het
Slc12a7	A	G	13: 73,788,677	E152G	probably benign	Het
Slc22a27	A	T	19: 7,896,762	M316K	probably damaging	Het
Spag1	G	T	15: 36,210,710	A427S	probably benign	Het
Sry	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG	Y: 2,662,638		probably benign	Het
Stk16	G	T	1: 75,211,351	C8F	probably damaging	Het
Syne2	T	C	12: 75,942,848	C1834R	probably damaging	Het
Tie1	C	T	4: 118,478,857		probably null	Het
Timp2	A	G	11: 118,303,895	I156T	probably damaging	Het
Tmem163	A	G	1: 127,491,610	M286T	possibly damaging	Het
Tmx4	T	A	2: 134,639,668	M112L	probably benign	Het
Trank1	G	T	9: 111,366,012	E1035*	probably null	Het
Trim5	C	T	7: 104,279,564	V57M	probably damaging	Het
Ubr3	A	G	2: 69,991,566	S1391G	probably benign	Het
Vmn1r72	A	T	7: 11,669,707	S271R	probably damaging	Het
Xpo5	G	A	17: 46,236,090		probably null	Het
Zfp592	A	T	7: 81,025,193	H635L	probably damaging	Het
Zfp791	A	T	8: 85,112,215	N62K	probably benign	Het
Zmynd11	G	A	13: 9,695,139	T248M	probably damaging	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1481:Arhgef5	UTSW	6	43274634	missense	probably damaging	0.99
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
R9610:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9611:Arhgef5	UTSW	6	43280956	missense	probably damaging	0.99
R9623:Arhgef5	UTSW	6	43274802	missense	possibly damaging	0.86
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCCAGGTACATTGTTCCCAG -3'
(R):5'- TCACATGGCCCACAATGATG -3'

Sequencing Primer
(F):5'- TATTCCACAGATTCAGAAGGAGCCTG -3'
(R):5'- ACAATGATGTGGAGTGTCAGCTG -3'

Posted On

2019-11-26