Incidental Mutation 'R7737:Zfp592'
ID596319
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Namezinc finger protein 592
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80993681-81045164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81025193 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 635 (H635L)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
Predicted Effect probably damaging
Transcript: ENSMUST00000107353
AA Change: H635L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: H635L

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 81041548 nonsense probably null
IGL01984:Zfp592 APN 7 81038644 missense probably benign 0.00
IGL02079:Zfp592 APN 7 81039230 missense probably benign 0.20
IGL02096:Zfp592 APN 7 81025048 missense probably damaging 1.00
IGL02125:Zfp592 APN 7 81038184 missense probably benign 0.00
IGL02374:Zfp592 APN 7 81024983 missense probably damaging 1.00
IGL02419:Zfp592 APN 7 81038245 missense probably damaging 1.00
IGL02466:Zfp592 APN 7 81023998 missense probably damaging 1.00
IGL02485:Zfp592 APN 7 81037970 splice site probably benign
IGL02500:Zfp592 APN 7 81041726 missense probably benign
IGL02876:Zfp592 APN 7 81038127 missense probably benign 0.01
IGL02940:Zfp592 APN 7 81024827 missense probably damaging 1.00
R0326:Zfp592 UTSW 7 81024889 missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 81038071 missense probably damaging 1.00
R0684:Zfp592 UTSW 7 81037875 missense probably benign 0.00
R0750:Zfp592 UTSW 7 81024745 missense probably benign
R1346:Zfp592 UTSW 7 81038064 missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 81024479 missense probably damaging 0.99
R1650:Zfp592 UTSW 7 81038100 missense probably benign 0.04
R1804:Zfp592 UTSW 7 81023695 missense probably damaging 1.00
R1918:Zfp592 UTSW 7 81037420 nonsense probably null
R2114:Zfp592 UTSW 7 81024796 missense probably damaging 1.00
R2144:Zfp592 UTSW 7 81038202 missense probably benign 0.01
R2164:Zfp592 UTSW 7 81041438 missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 81041613 missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 81037411 nonsense probably null
R3809:Zfp592 UTSW 7 81024532 missense probably benign 0.00
R4574:Zfp592 UTSW 7 81023786 missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 81041859 missense probably damaging 1.00
R5023:Zfp592 UTSW 7 81024347 missense probably damaging 1.00
R5121:Zfp592 UTSW 7 81023561 missense probably damaging 1.00
R5174:Zfp592 UTSW 7 81038325 missense probably damaging 1.00
R5794:Zfp592 UTSW 7 81025033 missense probably benign 0.00
R5946:Zfp592 UTSW 7 81037897 missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 81023436 missense probably benign 0.05
R6657:Zfp592 UTSW 7 81025486 missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R6872:Zfp592 UTSW 7 81023828 missense probably benign 0.02
R7056:Zfp592 UTSW 7 81023319 missense probably damaging 1.00
R7295:Zfp592 UTSW 7 81024322 missense probably damaging 1.00
R7351:Zfp592 UTSW 7 81041691 missense probably benign 0.00
R7475:Zfp592 UTSW 7 81023452 missense probably damaging 0.99
R7509:Zfp592 UTSW 7 81038340 missense probably damaging 0.99
R7552:Zfp592 UTSW 7 81023642 missense probably benign 0.01
R7752:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7901:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R7984:Zfp592 UTSW 7 81024721 missense probably benign 0.13
R8100:Zfp592 UTSW 7 81024192 missense probably benign 0.05
X0022:Zfp592 UTSW 7 81038187 nonsense probably null
X0028:Zfp592 UTSW 7 81024014 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTCCTTCACAGCTCTAACC -3'
(R):5'- TGGCATTGTCCAAAGTGGGG -3'

Sequencing Primer
(F):5'- TCTATGCGCCAAATCTCAGC -3'
(R):5'- TCCAAAGTGGGGCTGGG -3'
Posted On2019-11-26