Incidental Mutation 'R7737:Ankrd42'
ID596320
Institutional Source Beutler Lab
Gene Symbol Ankrd42
Ensembl Gene ENSMUSG00000041343
Gene Nameankyrin repeat domain 42
Synonyms4933417L02Rik, Ikbn
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7737 (G1)
Quality Score202.009
Status Validated
Chromosome7
Chromosomal Location92581723-92637142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92605262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 380 (T380A)
Ref Sequence ENSEMBL: ENSMUSP00000061208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056106] [ENSMUST00000118157] [ENSMUST00000126305] [ENSMUST00000138267] [ENSMUST00000207131] [ENSMUST00000207151]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056106
AA Change: T380A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061208
Gene: ENSMUSG00000041343
AA Change: T380A

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118157
AA Change: T380A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113767
Gene: ENSMUSG00000041343
AA Change: T380A

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 1.48e-3 SMART
ANK 158 187 2.11e2 SMART
ANK 191 220 9.78e-4 SMART
ANK 263 293 1.33e2 SMART
ANK 297 326 1.22e-4 SMART
coiled coil region 437 489 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126305
SMART Domains Protein: ENSMUSP00000123315
Gene: ENSMUSG00000041343

DomainStartEndE-ValueType
ANK 25 54 1.1e2 SMART
ANK 59 88 7.3e-3 SMART
ANK 92 121 6.71e-2 SMART
ANK 125 154 2.92e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138267
Predicted Effect probably benign
Transcript: ENSMUST00000207131
Predicted Effect probably benign
Transcript: ENSMUST00000207151
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Ankrd42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Ankrd42 APN 7 92584454 utr 3 prime probably benign
IGL01151:Ankrd42 APN 7 92605200 unclassified probably benign
IGL01444:Ankrd42 APN 7 92610585 missense probably damaging 0.96
IGL01933:Ankrd42 APN 7 92605285 missense probably benign
IGL03195:Ankrd42 APN 7 92591858 missense probably benign 0.33
IGL03397:Ankrd42 APN 7 92619554 missense probably damaging 1.00
R0128:Ankrd42 UTSW 7 92591859 nonsense probably null
R0278:Ankrd42 UTSW 7 92631657 missense possibly damaging 0.82
R0839:Ankrd42 UTSW 7 92612772 missense possibly damaging 0.92
R1227:Ankrd42 UTSW 7 92605300 missense possibly damaging 0.53
R1603:Ankrd42 UTSW 7 92619691 intron probably benign
R2281:Ankrd42 UTSW 7 92625773 nonsense probably null
R2299:Ankrd42 UTSW 7 92590254 missense probably benign 0.33
R2324:Ankrd42 UTSW 7 92623978 missense probably damaging 0.98
R2874:Ankrd42 UTSW 7 92605358 missense possibly damaging 0.71
R3940:Ankrd42 UTSW 7 92591788 splice site probably null
R4998:Ankrd42 UTSW 7 92624074 missense possibly damaging 0.71
R5579:Ankrd42 UTSW 7 92590182 missense possibly damaging 0.96
R5954:Ankrd42 UTSW 7 92623967 critical splice donor site probably null
R6140:Ankrd42 UTSW 7 92591828 splice site probably null
R6924:Ankrd42 UTSW 7 92582016 unclassified probably benign
R6944:Ankrd42 UTSW 7 92619547 critical splice donor site probably null
R7096:Ankrd42 UTSW 7 92591832 nonsense probably null
R7101:Ankrd42 UTSW 7 92631544 missense possibly damaging 0.53
R7155:Ankrd42 UTSW 7 92591933 missense possibly damaging 0.72
R7410:Ankrd42 UTSW 7 92610554 missense possibly damaging 0.93
R7500:Ankrd42 UTSW 7 92591872 missense probably benign 0.33
R7640:Ankrd42 UTSW 7 92619635 missense probably benign 0.14
R8669:Ankrd42 UTSW 7 92619673 missense possibly damaging 0.51
R8794:Ankrd42 UTSW 7 92614466 missense probably benign 0.32
X0065:Ankrd42 UTSW 7 92610555 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCAAGCATGTGTTACAAC -3'
(R):5'- TCTAAGTTAGTGTAGCCTGCAG -3'

Sequencing Primer
(F):5'- ACAACACATGTTTGGGGCTC -3'
(R):5'- GCCTGCAGTTTAAATATATGGATGC -3'
Posted On2019-11-26