Incidental Mutation 'R7737:Ephb1'
ID596328
Institutional Source Beutler Lab
Gene Symbol Ephb1
Ensembl Gene ENSMUSG00000032537
Gene NameEph receptor B1
SynonymsCek6, Net, C130099E04Rik, Hek6, Elk, Elkh
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location101922128-102354693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101984103 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 621 (I621F)
Ref Sequence ENSEMBL: ENSMUSP00000035129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035129] [ENSMUST00000085169]
Predicted Effect probably damaging
Transcript: ENSMUST00000035129
AA Change: I621F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035129
Gene: ENSMUSG00000032537
AA Change: I621F

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
Pfam:EphA2_TM 542 616 3e-24 PFAM
TyrKc 619 878 6.45e-141 SMART
SAM 908 975 1.22e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085169
SMART Domains Protein: ENSMUSP00000082261
Gene: ENSMUSG00000032537

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
EPH_lbd 19 196 1.69e-129 SMART
FN3 323 416 2.44e-5 SMART
FN3 434 515 2.26e-9 SMART
transmembrane domain 541 563 N/A INTRINSIC
TyrKc 585 837 2.35e-134 SMART
SAM 867 934 1.22e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin receptors and their ligands, the ephrins, mediate numerous developmental processes, particularly in the nervous system. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Ephrin receptors make up the largest subgroup of the receptor tyrosine kinase (RTK) family. The protein encoded by this gene is a receptor for ephrin-B family members. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions of this gene display marked reductions of the ipsilateral optic tract. Homozygotes for one null allele show reduced corticospinal tract and abnormal anterior commissure axon crossing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Ephb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Ephb1 APN 9 101996787 missense probably damaging 1.00
IGL01910:Ephb1 APN 9 102001857 missense probably benign 0.00
IGL02006:Ephb1 APN 9 102194772 critical splice donor site probably null
IGL02660:Ephb1 APN 9 102041092 missense possibly damaging 0.94
IGL02685:Ephb1 APN 9 102041103 nonsense probably null
IGL02802:Ephb1 UTSW 9 102010019 missense possibly damaging 0.87
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0098:Ephb1 UTSW 9 102041140 missense probably damaging 0.98
R0180:Ephb1 UTSW 9 101927504 missense probably damaging 0.99
R0488:Ephb1 UTSW 9 101964008 missense probably damaging 1.00
R0511:Ephb1 UTSW 9 101995980 splice site probably benign
R0601:Ephb1 UTSW 9 102195130 missense probably damaging 1.00
R1622:Ephb1 UTSW 9 102001711 missense probably benign 0.00
R1643:Ephb1 UTSW 9 101996825 missense probably damaging 0.99
R1645:Ephb1 UTSW 9 101927559 missense probably damaging 1.00
R1914:Ephb1 UTSW 9 101929378 missense probably damaging 1.00
R1964:Ephb1 UTSW 9 101971123 missense possibly damaging 0.93
R2245:Ephb1 UTSW 9 101996774 splice site probably benign
R2247:Ephb1 UTSW 9 101996811 missense probably damaging 0.98
R2412:Ephb1 UTSW 9 102001816 missense possibly damaging 0.85
R3716:Ephb1 UTSW 9 102194800 missense probably damaging 1.00
R3756:Ephb1 UTSW 9 102041039 missense probably benign 0.01
R3797:Ephb1 UTSW 9 101971267 missense probably damaging 1.00
R3907:Ephb1 UTSW 9 102001726 missense probably benign 0.00
R4981:Ephb1 UTSW 9 102040960 missense probably benign
R5112:Ephb1 UTSW 9 101971179 missense probably damaging 1.00
R5507:Ephb1 UTSW 9 101936116 missense probably damaging 1.00
R5745:Ephb1 UTSW 9 102195434 missense probably benign 0.25
R6082:Ephb1 UTSW 9 101971104 missense probably damaging 1.00
R6183:Ephb1 UTSW 9 102195325 missense probably damaging 1.00
R6228:Ephb1 UTSW 9 101923584 missense probably damaging 1.00
R6572:Ephb1 UTSW 9 102066898 missense probably benign
R6596:Ephb1 UTSW 9 102194802 nonsense probably null
R6813:Ephb1 UTSW 9 102010048 missense possibly damaging 0.87
R6876:Ephb1 UTSW 9 101984120 missense probably damaging 1.00
R6922:Ephb1 UTSW 9 101929264 splice site probably null
R6950:Ephb1 UTSW 9 102194909 missense probably benign 0.03
R7144:Ephb1 UTSW 9 101964077 missense probably damaging 1.00
R7146:Ephb1 UTSW 9 101963958 missense probably damaging 1.00
R7328:Ephb1 UTSW 9 102195239 missense probably damaging 1.00
R7644:Ephb1 UTSW 9 101936194 missense probably damaging 1.00
X0064:Ephb1 UTSW 9 101971272 missense probably damaging 1.00
Z1088:Ephb1 UTSW 9 101984145 missense probably damaging 0.99
Z1176:Ephb1 UTSW 9 102223398 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAAGCGTATCCACTGTGACC -3'
(R):5'- GTCCCTCCCAGAAATATCCTTGG -3'

Sequencing Primer
(F):5'- GTATCCACTGTGACCAAGGTC -3'
(R):5'- CCCAGAAATATCCTTGGTGCTGG -3'
Posted On2019-11-26