Incidental Mutation 'R7737:Noxred1'
ID 596337
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene Name NADP+ dependent oxidoreductase domain containing 1
Synonyms 4933437F05Rik
MMRRC Submission 045793-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R7737 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 87267897-87285375 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 87268136 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 332 (Q332*)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
AlphaFold Q9D3S5
Predicted Effect probably null
Transcript: ENSMUST00000021423
AA Change: Q332*
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: Q332*

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221768
Predicted Effect probably null
Transcript: ENSMUST00000222480
AA Change: Q332*
Meta Mutation Damage Score 0.9638 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 A T 8: 114,463,566 (GRCm39) probably null Het
Akap3 T A 6: 126,851,065 (GRCm39) M861K probably damaging Het
Ankrd42 T C 7: 92,254,470 (GRCm39) T380A possibly damaging Het
Arhgef5 A G 6: 43,250,728 (GRCm39) E493G possibly damaging Het
Arvcf G A 16: 18,214,966 (GRCm39) R119Q probably damaging Het
Asmt T C X: 169,110,175 (GRCm39) F228S probably damaging Het
Atp2c2 T A 8: 120,469,134 (GRCm39) V349E probably damaging Het
BC034090 A G 1: 155,117,419 (GRCm39) V233A possibly damaging Het
Brinp3 G T 1: 146,558,332 (GRCm39) K85N probably damaging Het
Ccr6 G A 17: 8,463,926 (GRCm39) probably benign Het
D7Ertd443e A G 7: 133,871,930 (GRCm39) S644P probably damaging Het
Ddb1 C T 19: 10,603,338 (GRCm39) A882V possibly damaging Het
Epha4 C T 1: 77,357,649 (GRCm39) G783D probably damaging Het
Ephb1 T A 9: 101,861,302 (GRCm39) I621F probably damaging Het
Fbxw18 G T 9: 109,530,331 (GRCm39) Y93* probably null Het
Fcgbpl1 T A 7: 27,856,498 (GRCm39) V2095E probably damaging Het
Gak A C 5: 108,764,874 (GRCm39) L84R probably benign Het
Gm5458 A T 14: 19,649,805 (GRCm39) probably null Het
Gpatch3 C G 4: 133,302,407 (GRCm39) Q113E probably benign Het
Gpld1 C A 13: 25,159,709 (GRCm39) L426M probably damaging Het
Ighmbp2 G A 19: 3,324,467 (GRCm39) P234S unknown Het
Itga6 G A 2: 71,652,787 (GRCm39) V217I probably benign Het
Kdm7a A T 6: 39,121,338 (GRCm39) N872K probably benign Het
Klhl14 G T 18: 21,691,191 (GRCm39) Y446* probably null Het
Larp4b T A 13: 9,220,679 (GRCm39) probably null Het
Lct A T 1: 128,226,430 (GRCm39) W1320R probably benign Het
Lrp2 T C 2: 69,326,782 (GRCm39) D1763G possibly damaging Het
Lrrk2 A T 15: 91,699,649 (GRCm39) N2499Y probably damaging Het
Lsg1 T C 16: 30,400,003 (GRCm39) probably null Het
Mettl15 T C 2: 108,967,723 (GRCm39) K188E probably damaging Het
Mfsd4b1 A G 10: 39,879,274 (GRCm39) S208P probably damaging Het
Mlxipl T C 5: 135,164,235 (GRCm39) S793P possibly damaging Het
Ms4a14 G A 19: 11,280,150 (GRCm39) Q803* probably null Het
Mtor A C 4: 148,623,195 (GRCm39) E2015A possibly damaging Het
Myo15b A T 11: 115,778,749 (GRCm39) Y2581F unknown Het
Myo7b A T 18: 32,147,257 (GRCm39) Y95* probably null Het
Nf1 A G 11: 79,436,314 (GRCm39) I1985V probably benign Het
Nudt21 A T 8: 94,749,461 (GRCm39) Y202N probably damaging Het
Odad2 A G 18: 7,217,890 (GRCm39) L608P probably damaging Het
Or1j16 A T 2: 36,530,632 (GRCm39) I194F probably benign Het
Pik3c2a A T 7: 115,955,488 (GRCm39) S1176T probably damaging Het
Pramel14 A C 4: 143,718,526 (GRCm39) S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,348,367 (GRCm39) probably benign Het
Rbmxl1 A G 8: 79,232,252 (GRCm39) S364P unknown Het
Rnf24 T A 2: 131,145,416 (GRCm39) K131N probably benign Het
Scai T A 2: 39,013,034 (GRCm39) Q132L probably damaging Het
Sh3tc1 T C 5: 35,881,297 (GRCm39) R49G probably benign Het
Slc12a7 A G 13: 73,936,796 (GRCm39) E152G probably benign Het
Slc22a27 A T 19: 7,874,127 (GRCm39) M316K probably damaging Het
Spag1 G T 15: 36,210,856 (GRCm39) A427S probably benign Het
Speer4a3 AACT A 5: 26,155,849 (GRCm39) probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 (GRCm39) probably benign Het
Stk16 G T 1: 75,187,995 (GRCm39) C8F probably damaging Het
Syne2 T C 12: 75,989,622 (GRCm39) C1834R probably damaging Het
Tie1 C T 4: 118,336,054 (GRCm39) probably null Het
Timp2 A G 11: 118,194,721 (GRCm39) I156T probably damaging Het
Tmem163 A G 1: 127,419,347 (GRCm39) M286T possibly damaging Het
Tmx4 T A 2: 134,481,588 (GRCm39) M112L probably benign Het
Trank1 G T 9: 111,195,080 (GRCm39) E1035* probably null Het
Trim5 C T 7: 103,928,771 (GRCm39) V57M probably damaging Het
Ubr3 A G 2: 69,821,910 (GRCm39) S1391G probably benign Het
Vmn1r72 A T 7: 11,403,634 (GRCm39) S271R probably damaging Het
Xpo5 G A 17: 46,547,016 (GRCm39) probably null Het
Zfp592 A T 7: 80,674,941 (GRCm39) H635L probably damaging Het
Zfp791 A T 8: 85,838,844 (GRCm39) N62K probably benign Het
Zfp998 A G 13: 66,581,738 (GRCm39) probably null Het
Zmynd11 G A 13: 9,745,175 (GRCm39) T248M probably damaging Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87,269,955 (GRCm39) missense probably benign 0.05
IGL01950:Noxred1 APN 12 87,268,190 (GRCm39) missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87,271,776 (GRCm39) missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87,280,212 (GRCm39) missense probably damaging 1.00
PIT4402001:Noxred1 UTSW 12 87,273,855 (GRCm39) missense probably benign 0.00
PIT4504001:Noxred1 UTSW 12 87,271,653 (GRCm39) missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0242:Noxred1 UTSW 12 87,273,753 (GRCm39) missense probably benign 0.02
R0514:Noxred1 UTSW 12 87,273,838 (GRCm39) missense probably benign 0.01
R0992:Noxred1 UTSW 12 87,271,000 (GRCm39) missense probably benign 0.15
R1626:Noxred1 UTSW 12 87,268,029 (GRCm39) makesense probably null
R2370:Noxred1 UTSW 12 87,273,820 (GRCm39) missense probably benign 0.00
R3692:Noxred1 UTSW 12 87,280,240 (GRCm39) missense probably benign 0.26
R4084:Noxred1 UTSW 12 87,280,258 (GRCm39) missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87,270,976 (GRCm39) missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87,273,810 (GRCm39) missense probably benign 0.00
R6977:Noxred1 UTSW 12 87,268,091 (GRCm39) missense probably null 0.00
R7388:Noxred1 UTSW 12 87,273,799 (GRCm39) missense probably damaging 0.99
R7535:Noxred1 UTSW 12 87,280,206 (GRCm39) missense probably benign 0.00
R7877:Noxred1 UTSW 12 87,271,761 (GRCm39) missense probably benign 0.34
R7939:Noxred1 UTSW 12 87,268,105 (GRCm39) missense probably benign 0.00
R8772:Noxred1 UTSW 12 87,273,867 (GRCm39) missense probably benign 0.14
R8785:Noxred1 UTSW 12 87,270,940 (GRCm39) missense probably benign 0.00
R9470:Noxred1 UTSW 12 87,269,829 (GRCm39) missense possibly damaging 0.74
R9718:Noxred1 UTSW 12 87,271,692 (GRCm39) missense possibly damaging 0.91
Z1176:Noxred1 UTSW 12 87,269,831 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAAGAATACTGACATATAGAGG -3'
(R):5'- TCCATACAGCTCCGCCATTG -3'

Sequencing Primer
(F):5'- CAGAACTCATGGCTCTCT -3'
(R):5'- AGCTCCGCCATTGCTGTTC -3'
Posted On 2019-11-26