Incidental Mutation 'R7737:Zmynd11'
ID596339
Institutional Source Beutler Lab
Gene Symbol Zmynd11
Ensembl Gene ENSMUSG00000021156
Gene Namezinc finger, MYND domain containing 11
Synonyms2210402G22Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.725) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location9684833-9765330 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 9695139 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 248 (T248M)
Ref Sequence ENSEMBL: ENSMUSP00000106266 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062658] [ENSMUST00000110633] [ENSMUST00000110634] [ENSMUST00000110635] [ENSMUST00000110636] [ENSMUST00000110637] [ENSMUST00000110638] [ENSMUST00000128658] [ENSMUST00000130151] [ENSMUST00000144642] [ENSMUST00000146059] [ENSMUST00000152725] [ENSMUST00000154994] [ENSMUST00000157035] [ENSMUST00000220996] [ENSMUST00000222475] [ENSMUST00000223421]
Predicted Effect probably damaging
Transcript: ENSMUST00000062658
AA Change: T194M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059767
Gene: ENSMUSG00000021156
AA Change: T194M

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110633
AA Change: T208M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106263
Gene: ENSMUSG00000021156
AA Change: T208M

DomainStartEndE-ValueType
PHD 62 106 4.19e-7 SMART
RING 66 105 8.31e-1 SMART
BROMO 111 217 1.03e-18 SMART
PWWP 238 289 1.96e-21 SMART
low complexity region 332 345 N/A INTRINSIC
low complexity region 418 437 N/A INTRINSIC
coiled coil region 503 543 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110634
AA Change: T248M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106264
Gene: ENSMUSG00000021156
AA Change: T248M

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110635
AA Change: T217M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106265
Gene: ENSMUSG00000021156
AA Change: T217M

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 133 226 3.35e-4 SMART
PWWP 247 298 1.96e-21 SMART
low complexity region 341 354 N/A INTRINSIC
low complexity region 374 385 N/A INTRINSIC
coiled coil region 456 496 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110636
AA Change: T248M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106266
Gene: ENSMUSG00000021156
AA Change: T248M

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 257 1.03e-18 SMART
PWWP 278 329 1.96e-21 SMART
low complexity region 372 385 N/A INTRINSIC
low complexity region 405 416 N/A INTRINSIC
coiled coil region 487 527 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110637
AA Change: T194M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106267
Gene: ENSMUSG00000021156
AA Change: T194M

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 351 362 N/A INTRINSIC
coiled coil region 433 473 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110638
AA Change: T194M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106268
Gene: ENSMUSG00000021156
AA Change: T194M

DomainStartEndE-ValueType
BROMO 97 203 1.03e-18 SMART
PWWP 224 275 1.96e-21 SMART
low complexity region 318 331 N/A INTRINSIC
low complexity region 404 423 N/A INTRINSIC
coiled coil region 489 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128658
SMART Domains Protein: ENSMUSP00000121574
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 97 149 8e-32 BLAST
PDB:4N4I|A 99 149 6e-29 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000130151
AA Change: T263M

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118964
Gene: ENSMUSG00000021156
AA Change: T263M

DomainStartEndE-ValueType
PHD 117 161 4.19e-7 SMART
RING 121 160 8.31e-1 SMART
BROMO 166 272 1.03e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140180
Predicted Effect probably benign
Transcript: ENSMUST00000144642
SMART Domains Protein: ENSMUSP00000117375
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146059
SMART Domains Protein: ENSMUSP00000122133
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
Blast:BROMO 38 81 1e-23 BLAST
PDB:4N4I|A 59 89 2e-13 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152725
SMART Domains Protein: ENSMUSP00000118002
Gene: ENSMUSG00000021156

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
Blast:BROMO 151 203 8e-31 BLAST
PDB:4N4I|A 153 203 2e-27 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000154994
AA Change: T248M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116635
Gene: ENSMUSG00000021156
AA Change: T248M

DomainStartEndE-ValueType
PHD 102 146 4.19e-7 SMART
RING 106 145 8.31e-1 SMART
BROMO 151 249 1.59e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000157035
Predicted Effect probably benign
Transcript: ENSMUST00000220996
Predicted Effect probably damaging
Transcript: ENSMUST00000222475
AA Change: T163M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223421
AA Change: T247M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was first identified by its ability to bind the adenovirus E1A protein. The protein localizes to the nucleus. It functions as a transcriptional repressor, and expression of E1A inhibits this repression. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Other mutations in Zmynd11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Zmynd11 APN 13 9689226 missense probably damaging 0.97
IGL00846:Zmynd11 APN 13 9720772 critical splice donor site probably null
IGL01606:Zmynd11 APN 13 9697688 missense probably damaging 1.00
IGL03229:Zmynd11 APN 13 9689565 missense probably damaging 1.00
R1173:Zmynd11 UTSW 13 9689549 missense probably damaging 1.00
R1413:Zmynd11 UTSW 13 9710220 missense probably damaging 1.00
R1813:Zmynd11 UTSW 13 9689580 missense possibly damaging 0.53
R1872:Zmynd11 UTSW 13 9698701 missense possibly damaging 0.88
R2002:Zmynd11 UTSW 13 9689478 unclassified probably null
R2991:Zmynd11 UTSW 13 9695822 missense probably damaging 0.99
R4273:Zmynd11 UTSW 13 9697690 missense probably damaging 1.00
R4708:Zmynd11 UTSW 13 9695753 missense probably damaging 0.97
R4718:Zmynd11 UTSW 13 9689567 missense possibly damaging 0.86
R5011:Zmynd11 UTSW 13 9689443 unclassified probably benign
R5151:Zmynd11 UTSW 13 9690917 missense probably damaging 1.00
R5963:Zmynd11 UTSW 13 9695895 intron probably benign
R6648:Zmynd11 UTSW 13 9713021 missense probably benign 0.11
R7002:Zmynd11 UTSW 13 9694330 missense probably damaging 1.00
R7223:Zmynd11 UTSW 13 9710162 missense probably benign 0.09
R7322:Zmynd11 UTSW 13 9690409 missense possibly damaging 0.53
R7462:Zmynd11 UTSW 13 9698684 missense probably benign 0.29
R7500:Zmynd11 UTSW 13 9735398 missense probably benign 0.00
R8181:Zmynd11 UTSW 13 9689651 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GAGCAGTGCTTCAAAGTTACTAAAG -3'
(R):5'- CCTGTGCCACCTGAACATTC -3'

Sequencing Primer
(F):5'- GCCATAACATGTTGTTAAGTTTTTCC -3'
(R):5'- TGTGCCACCTGAACATTCTATAAAAC -3'
Posted On2019-11-26