Incidental Mutation 'R7737:Gpld1'
ID596340
Institutional Source Beutler Lab
Gene Symbol Gpld1
Ensembl Gene ENSMUSG00000021340
Gene Nameglycosylphosphatidylinositol specific phospholipase D1
Synonyms6330541J12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24943152-24992501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 24975726 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 426 (L426M)
Ref Sequence ENSEMBL: ENSMUSP00000021773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021773]
Predicted Effect probably damaging
Transcript: ENSMUST00000021773
AA Change: L426M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021773
Gene: ENSMUSG00000021340
AA Change: L426M

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Zn_dep_PLPC 28 219 9.8e-28 PFAM
Int_alpha 377 435 7.21e-11 SMART
Int_alpha 446 503 7.43e-13 SMART
Int_alpha 509 565 7.86e-3 SMART
Int_alpha 576 643 4.09e0 SMART
Blast:Int_alpha 644 708 2e-24 BLAST
Int_alpha 716 774 1.86e-4 SMART
Blast:Int_alpha 789 837 1e-16 BLAST
Meta Mutation Damage Score 0.3364 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Many proteins are tethered to the extracellular face of eukaryotic plasma membranes by a glycosylphosphatidylinositol (GPI) anchor. The GPI-anchor is a glycolipid found on many blood cells. The protein encoded by this gene is a GPI degrading enzyme. Glycosylphosphatidylinositol specific phospholipase D1 hydrolyzes the inositol phosphate linkage in proteins anchored by phosphatidylinositol glycans, thereby releasing the attached protein from the plasma membrane. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Spag1 G T 15: 36,210,710 A427S probably benign Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Gpld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Gpld1 APN 13 24986922 splice site probably benign
IGL00886:Gpld1 APN 13 24962353 nonsense probably null
IGL01060:Gpld1 APN 13 24982566 missense probably damaging 1.00
IGL01450:Gpld1 APN 13 24979681 missense probably damaging 1.00
IGL02176:Gpld1 APN 13 24984209 critical splice donor site probably null
IGL02288:Gpld1 APN 13 24979683 nonsense probably null
IGL02323:Gpld1 APN 13 24982774 missense probably damaging 0.97
IGL02588:Gpld1 APN 13 24943699 missense probably damaging 1.00
IGL02832:Gpld1 APN 13 24952878 missense probably damaging 1.00
IGL02989:Gpld1 APN 13 24990036 missense possibly damaging 0.87
IGL03282:Gpld1 APN 13 24971408 missense probably benign 0.01
IGL03345:Gpld1 APN 13 24987024 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0017:Gpld1 UTSW 13 24990118 missense probably damaging 1.00
R0308:Gpld1 UTSW 13 24962835 missense possibly damaging 0.81
R0441:Gpld1 UTSW 13 24962320 nonsense probably null
R1172:Gpld1 UTSW 13 24957566 splice site probably null
R1411:Gpld1 UTSW 13 24962808 missense probably damaging 0.99
R1502:Gpld1 UTSW 13 24971416 missense probably benign 0.00
R1565:Gpld1 UTSW 13 24956068 missense probably damaging 0.99
R1931:Gpld1 UTSW 13 24943710 missense possibly damaging 0.71
R1999:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2150:Gpld1 UTSW 13 24962647 missense probably benign 0.23
R2240:Gpld1 UTSW 13 24982507 critical splice acceptor site probably null
R2327:Gpld1 UTSW 13 24984821 missense probably benign 0.00
R2373:Gpld1 UTSW 13 24962856 missense probably benign 0.26
R3153:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24943620 missense unknown
R3154:Gpld1 UTSW 13 24956163 critical splice donor site probably null
R3911:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R4616:Gpld1 UTSW 13 24984816 missense probably damaging 1.00
R4660:Gpld1 UTSW 13 24982603 unclassified probably null
R4755:Gpld1 UTSW 13 24979688 missense probably benign 0.13
R4755:Gpld1 UTSW 13 24979692 nonsense probably null
R4835:Gpld1 UTSW 13 24982716 missense probably benign 0.00
R4895:Gpld1 UTSW 13 24979728 missense probably damaging 0.97
R5050:Gpld1 UTSW 13 24962756 missense probably benign 0.00
R5182:Gpld1 UTSW 13 24984070 unclassified probably null
R6161:Gpld1 UTSW 13 24971414 missense probably benign 0.00
R6626:Gpld1 UTSW 13 24979970 missense probably damaging 1.00
R7021:Gpld1 UTSW 13 24984708 missense probably damaging 1.00
R7577:Gpld1 UTSW 13 24962405 missense probably benign 0.05
R7583:Gpld1 UTSW 13 24975760 missense probably damaging 1.00
R7659:Gpld1 UTSW 13 24979981 missense probably benign 0.00
R7738:Gpld1 UTSW 13 24962322 missense probably damaging 1.00
R7752:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
R7759:Gpld1 UTSW 13 24962400 missense probably damaging 0.99
R7901:Gpld1 UTSW 13 24962775 missense probably damaging 1.00
X0024:Gpld1 UTSW 13 24982596 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGTGTGACTGTAGCCC -3'
(R):5'- GCCAACTGTTACTGTAATTATTCTCCT -3'

Sequencing Primer
(F):5'- TGTAGCCCACAGCCCTC -3'
(R):5'- AGAGCACTTGTCAGTCATGC -3'
Posted On2019-11-26