Incidental Mutation 'R7737:Spag1'
ID596343
Institutional Source Beutler Lab
Gene Symbol Spag1
Ensembl Gene ENSMUSG00000037617
Gene Namesperm associated antigen 1
Synonymstpis, TPR-containing protein involved in spermatogenesis
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R7737 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location36178099-36235621 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36210710 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 427 (A427S)
Ref Sequence ENSEMBL: ENSMUSP00000047335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047348] [ENSMUST00000171205]
Predicted Effect probably benign
Transcript: ENSMUST00000047348
AA Change: A427S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047335
Gene: ENSMUSG00000037617
AA Change: A427S

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171205
AA Change: A427S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132233
Gene: ENSMUSG00000037617
AA Change: A427S

DomainStartEndE-ValueType
TPR 213 246 1.88e0 SMART
TPR 247 279 3.47e-4 SMART
TPR 280 313 8.23e-6 SMART
low complexity region 383 400 N/A INTRINSIC
TPR 430 463 5.92e1 SMART
TPR 472 505 2.49e-5 SMART
TPR 506 539 5.31e0 SMART
TPR 606 639 7.63e-1 SMART
TPR 640 673 1.38e-7 SMART
Pfam:RPAP3_C 777 869 1.7e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm agglutinating antibodies from an infertile woman. Furthermore, immunization of female rats with the recombinant human protein reduced fertility. This protein localizes to the plasma membrane of germ cells in the testis and to the post-acrosomal plasma membrane of mature spermatozoa. Recombinant polypeptide binds GTP and exhibits GTPase activity. Thus, this protein may regulate GTP signal transduction pathways involved in spermatogenesis and fertilization. Two transcript variants of this gene encode the same protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410141K09Rik A G 13: 66,433,677 probably null Het
9530053A07Rik T A 7: 28,157,073 V2095E probably damaging Het
Adamts18 A T 8: 113,736,934 probably null Het
Akap3 T A 6: 126,874,102 M861K probably damaging Het
Ankrd42 T C 7: 92,605,262 T380A possibly damaging Het
Arhgef5 A G 6: 43,273,794 E493G possibly damaging Het
Armc4 A G 18: 7,217,890 L608P probably damaging Het
Arvcf G A 16: 18,397,101 R119Q probably damaging Het
Asmt T C X: 170,676,440 F228S probably damaging Het
Atp2c2 T A 8: 119,742,395 V349E probably damaging Het
BC034090 A G 1: 155,241,673 V233A possibly damaging Het
Brinp3 G T 1: 146,682,594 K85N probably damaging Het
Ccr6 G A 17: 8,245,094 probably benign Het
D7Ertd443e A G 7: 134,270,201 S644P probably damaging Het
Ddb1 C T 19: 10,625,974 A882V possibly damaging Het
Epha4 C T 1: 77,381,012 G783D probably damaging Het
Ephb1 T A 9: 101,984,103 I621F probably damaging Het
Fbxw18 G T 9: 109,701,263 Y93* probably null Het
Gak A C 5: 108,617,008 L84R probably benign Het
Gm21671 AACT A 5: 25,950,851 probably benign Het
Gm5458 A T 14: 19,599,737 probably null Het
Gpatch3 C G 4: 133,575,096 Q113E probably benign Het
Gpld1 C A 13: 24,975,726 L426M probably damaging Het
Ighmbp2 G A 19: 3,274,467 P234S unknown Het
Itga6 G A 2: 71,822,443 V217I probably benign Het
Kdm7a A T 6: 39,144,404 N872K probably benign Het
Klhl14 G T 18: 21,558,134 Y446* probably null Het
Larp4b T A 13: 9,170,643 probably null Het
Lct A T 1: 128,298,693 W1320R probably benign Het
Lrp2 T C 2: 69,496,438 D1763G possibly damaging Het
Lrrk2 A T 15: 91,815,446 N2499Y probably damaging Het
Lsg1 T C 16: 30,581,185 probably null Het
Mettl15 T C 2: 109,137,378 K188E probably damaging Het
Mfsd4b1 A G 10: 40,003,278 S208P probably damaging Het
Mlxipl T C 5: 135,135,381 S793P possibly damaging Het
Ms4a14 G A 19: 11,302,786 Q803* probably null Het
Mtor A C 4: 148,538,738 E2015A possibly damaging Het
Myo15b A T 11: 115,887,923 Y2581F unknown Het
Myo7b A T 18: 32,014,204 Y95* probably null Het
Nf1 A G 11: 79,545,488 I1985V probably benign Het
Noxred1 G A 12: 87,221,362 Q332* probably null Het
Nudt21 A T 8: 94,022,833 Y202N probably damaging Het
Olfr345 A T 2: 36,640,620 I194F probably benign Het
Pik3c2a A T 7: 116,356,253 S1176T probably damaging Het
Pramef17 A C 4: 143,991,956 S306A possibly damaging Het
Qrich2 GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG 11: 116,457,541 probably benign Het
Rbmxl1 A G 8: 78,505,623 S364P unknown Het
Rnf24 T A 2: 131,303,496 K131N probably benign Het
Scai T A 2: 39,123,022 Q132L probably damaging Het
Sh3tc1 T C 5: 35,723,953 R49G probably benign Het
Slc12a7 A G 13: 73,788,677 E152G probably benign Het
Slc22a27 A T 19: 7,896,762 M316K probably damaging Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Stk16 G T 1: 75,211,351 C8F probably damaging Het
Syne2 T C 12: 75,942,848 C1834R probably damaging Het
Tie1 C T 4: 118,478,857 probably null Het
Timp2 A G 11: 118,303,895 I156T probably damaging Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmx4 T A 2: 134,639,668 M112L probably benign Het
Trank1 G T 9: 111,366,012 E1035* probably null Het
Trim5 C T 7: 104,279,564 V57M probably damaging Het
Ubr3 A G 2: 69,991,566 S1391G probably benign Het
Vmn1r72 A T 7: 11,669,707 S271R probably damaging Het
Xpo5 G A 17: 46,236,090 probably null Het
Zfp592 A T 7: 81,025,193 H635L probably damaging Het
Zfp791 A T 8: 85,112,215 N62K probably benign Het
Zmynd11 G A 13: 9,695,139 T248M probably damaging Het
Other mutations in Spag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Spag1 APN 15 36195416 nonsense probably null
IGL00465:Spag1 APN 15 36183821 unclassified probably benign
IGL00694:Spag1 APN 15 36227171 missense possibly damaging 0.94
IGL01479:Spag1 APN 15 36233199 splice site probably benign
IGL01830:Spag1 APN 15 36221559 missense probably benign 0.01
IGL02072:Spag1 APN 15 36190512 missense probably damaging 1.00
IGL02232:Spag1 APN 15 36221564 missense probably benign 0.00
IGL02727:Spag1 APN 15 36234818 missense probably damaging 1.00
IGL02810:Spag1 APN 15 36234547 missense probably damaging 1.00
IGL03010:Spag1 APN 15 36233273 missense probably benign 0.15
IGL03069:Spag1 APN 15 36224099 splice site probably benign
IGL03244:Spag1 APN 15 36234383 missense probably benign 0.00
FR4737:Spag1 UTSW 15 36197733 critical splice acceptor site probably benign
R0863:Spag1 UTSW 15 36192047 missense probably damaging 1.00
R1177:Spag1 UTSW 15 36234767 missense probably benign 0.21
R1878:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R1879:Spag1 UTSW 15 36181770 missense probably damaging 1.00
R2086:Spag1 UTSW 15 36227141 missense probably damaging 0.98
R2093:Spag1 UTSW 15 36224130 missense probably damaging 1.00
R2231:Spag1 UTSW 15 36191167 missense probably benign 0.01
R4030:Spag1 UTSW 15 36234301 missense probably damaging 0.99
R4893:Spag1 UTSW 15 36197846 critical splice donor site probably null
R5047:Spag1 UTSW 15 36195442 missense probably damaging 1.00
R5505:Spag1 UTSW 15 36234626 missense probably damaging 0.99
R5741:Spag1 UTSW 15 36183703 missense possibly damaging 0.79
R5805:Spag1 UTSW 15 36200284 missense probably damaging 1.00
R6221:Spag1 UTSW 15 36197803 missense probably benign 0.30
R6236:Spag1 UTSW 15 36211135 missense probably damaging 1.00
R6556:Spag1 UTSW 15 36195407 missense probably damaging 1.00
R6800:Spag1 UTSW 15 36197749 nonsense probably null
Z1177:Spag1 UTSW 15 36186676 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGACAGGGATGTATGTACTCACC -3'
(R):5'- TCCCAGTATTGTTCACGGTAC -3'

Sequencing Primer
(F):5'- GGATGTATGTACTCACCTCCCGG -3'
(R):5'- GTTCACGGTACCCTTAGTCAGCAG -3'
Posted On2019-11-26